Regulog GntR - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By trascription factor - GntR
- By TF family - LacI
- By effector - Gluconate
- By pathway - Gluconate utilization
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | 5 | 2 |
| Acidovorax sp. JS42 | 7 | 2 |
| Comamonas testosteroni KF-1 | 7 | 2 |
| Delftia acidovorans SPH-1 | 7 | 2 |
| Polaromonas naphthalenivorans CJ2 | 5 | 2 |
| Polaromonas sp. JS666 | ||
| Rhodoferax ferrireducens DSM 15236 | 2 | 2 |
| Variovorax paradoxus S110 | 3 | 2 |
| Verminephrobacter eiseniae EF01-2 | ||
| Methylibium petroleiphilum PM1 | ||
| Leptothrix cholodnii SP-6 | 2 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| gntK |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -109 score = 6.07601 sequence = CTAGGATAGCGCTATCTTGC Gene: Aave_2797: Thermoresistant gluconokinase (EC 2.7.1.12) |
*
Acidovorax sp. JS42 Site: position = -180 score = 6.04656 sequence = TTAAGATAGCGCTATCTTTC Gene: Ajs_2053: Thermoresistant gluconokinase (EC 2.7.1.12) |
*
Comamonas testosteroni KF-1 Site: position = -21 score = 6.34252 sequence = ATCGGATAGCGCTATCCAAA Site: position = -147 score = 6.01302 sequence = TTATGATAGCGCTATCCGGA Gene: CtesDRAFT_0561: Thermoresistant gluconokinase (EC 2.7.1.12) |
*
Delftia acidovorans SPH-1 Site: position = -120 score = 6.27531 sequence = TTATGATAGCGCTATCCCAA Gene: Daci_3761: Thermoresistant gluconokinase (EC 2.7.1.12) |
*
Polaromonas naphthalenivorans CJ2 Site: position = -140 score = 6.46716 sequence = ATAGGATAGCGCTATCCCAA Site: position = -30 score = 6.10489 sequence = AACGGATAGCGCTATCCAAG Gene: Pnap_0046: Thermoresistant gluconokinase (EC 2.7.1.12) |
|
*
Rhodoferax ferrireducens DSM 15236 Site: position = -33 score = 6.05178 sequence = TTAAGATAGCGCTATCTATT Gene: Rfer_0956: Thermoresistant gluconokinase (EC 2.7.1.12) |
|
|
|
*
Leptothrix cholodnii SP-6 Site: position = -128 score = 6.55702 sequence = CTAGGATAGCGCTATCCAAA Site: position = -19 score = 6.01059 sequence = ACGAGATAGCGCTATCCAAA Gene: Lcho_0327: Thermoresistant gluconokinase (EC 2.7.1.12) |
Thermoresistant gluconokinase (EC 2.7.1.12) |
| gntY |
Gene: Aave_2796: Predicted gluconate TRAP family transporter, DctQ subunit |
Gene: Ajs_2052: Predicted gluconate TRAP family transporter, DctQ subunit |
Gene: CtesDRAFT_0560: Predicted gluconate TRAP family transporter, DctQ subunit |
Gene: Daci_3762: Predicted gluconate TRAP family transporter, DctQ subunit |
Gene: Pnap_0045: Predicted gluconate TRAP family transporter, DctQ subunit |
|
|
|
|
|
|
Predicted gluconate TRAP family transporter, DctQ subunit |
| gntZ |
Gene: Aave_2795: Predicted gluconate TRAP family transporter, DctM subunit |
Gene: Ajs_2051: Predicted gluconate TRAP family transporter, DctM subunit |
Gene: CtesDRAFT_0559: Predicted gluconate TRAP family transporter, DctM subunit |
Gene: Daci_3763: Predicted gluconate TRAP family transporter, DctM subunit |
Gene: Pnap_0044: Predicted gluconate TRAP family transporter, DctM subunit |
|
|
|
|
|
|
Predicted gluconate TRAP family transporter, DctM subunit |
| gntX |
Gene: Aave_2794: Predicted gluconate TRAP family transporter, DctP subunit |
Gene: Ajs_2050: Predicted gluconate TRAP family transporter, DctP subunit |
Gene: CtesDRAFT_0558: Predicted gluconate TRAP family transporter, DctP subunit |
Gene: Daci_3764: Predicted gluconate TRAP family transporter, DctP subunit |
Gene: Pnap_0043: Predicted gluconate TRAP family transporter, DctP subunit |
|
|
|
|
|
|
Predicted gluconate TRAP family transporter, DctP subunit |
| edd |
Gene: Aave_2793: 6-phosphogluconate dehydratase (EC 4.2.1.12) |
Gene: Ajs_2049: 6-phosphogluconate dehydratase (EC 4.2.1.12) |
Gene: CtesDRAFT_0557: 6-phosphogluconate dehydratase (EC 4.2.1.12) |
Gene: Daci_3765: 6-phosphogluconate dehydratase (EC 4.2.1.12) |
Gene: Pnap_2986: 6-phosphogluconate dehydratase (EC 4.2.1.12) |
Gene: Bpro_3551: 6-phosphogluconate dehydratase (EC 4.2.1.12) |
Gene: Rfer_2060: 6-phosphogluconate dehydratase (EC 4.2.1.12) |
Gene: Vapar_3708: 6-phosphogluconate dehydratase (EC 4.2.1.12) |
Gene: Veis_2570: 6-phosphogluconate dehydratase (EC 4.2.1.12) |
|
Gene: Lcho_2919: 6-phosphogluconate dehydratase (EC 4.2.1.12) |
6-phosphogluconate dehydratase (EC 4.2.1.12) |
| eda |
Gene: Aave_2792: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
Gene: Ajs_2048: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
Gene: CtesDRAFT_0556: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
Gene: Daci_3766: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
Gene: Pnap_2985: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
Gene: Bpro_3550: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
Gene: Rfer_2061: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
Gene: Vapar_3707: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
Gene: Veis_2569: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
|
Gene: Lcho_2918: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14) |
| CRON 2. | ||||||||||||
| gntT |
|
|
|
|
|
|
|
*
Variovorax paradoxus S110 Site: position = -66 score = 5.77646 sequence = GCGGGATAGCGCTATCCCTG Site: position = -141 score = 6.10389 sequence = CTAGGATAGCGCTGTCCCAG Site: position = -157 score = 5.7446 sequence = ATTGGACAGCGCTGTCCTAG Gene: Vapar_6142: High-affinity H+/gluconate symporter |
|
|
|
High-affinity H+/gluconate symporter |
| gntK3 |
|
|
|
|
|
|
|
Gene: Vapar_6143: Gluconokinase, Firmicutes type (EC 2.7.1.12) |
|
|
|
Gluconokinase, Firmicutes type (EC 2.7.1.12) |
| CRON 3. | ||||||||||||
| gntR |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -55 score = 6.07601 sequence = GCAAGATAGCGCTATCCTAG Site: position = -172 score = 6.10489 sequence = CTTGGATAGCGCTATCCGTT Gene: Aave_2798: Gluconate utilization transcriptional regulator GntR, LacI family |
*
Acidovorax sp. JS42 Site: position = -55 score = 6.04656 sequence = GAAAGATAGCGCTATCTTAA Site: position = -219 score = 6.02303 sequence = TCAAGATAGCGCTATCTTTA Gene: Ajs_2054: Gluconate utilization transcriptional regulator GntR, LacI family |
*
Comamonas testosteroni KF-1 Site: position = -181 score = 6.34252 sequence = TTTGGATAGCGCTATCCGAT Site: position = -55 score = 6.01302 sequence = TCCGGATAGCGCTATCATAA Gene: CtesDRAFT_0562: Gluconate utilization transcriptional regulator GntR, LacI family |
*
Delftia acidovorans SPH-1 Site: position = -175 score = 6.24875 sequence = TTGGGATAGCGCTATCCATG Site: position = -56 score = 6.27531 sequence = TTGGGATAGCGCTATCATAA Gene: Daci_3760: Gluconate utilization transcriptional regulator GntR, LacI family |
*
Polaromonas naphthalenivorans CJ2 Site: position = -128 score = 6.10489 sequence = CTTGGATAGCGCTATCCGTT Gene: Pnap_0047: Gluconate utilization transcriptional regulator GntR, LacI family |
|
*
Rhodoferax ferrireducens DSM 15236 Site: position = -197 score = 6.05178 sequence = AATAGATAGCGCTATCTTAA Gene: Rfer_0957: Gluconate utilization transcriptional regulator GntR, LacI family |
*
Variovorax paradoxus S110 Site: position = -70 score = 6.10389 sequence = CTGGGACAGCGCTATCCTAG Site: position = -54 score = 5.7446 sequence = CTAGGACAGCGCTGTCCAAT Site: position = -145 score = 5.77646 sequence = CAGGGATAGCGCTATCCCGC Gene: Vapar_6141: Gluconate utilization transcriptional regulator GntR, LacI family |
|
|
*
Leptothrix cholodnii SP-6 Site: position = -170 score = 6.01059 sequence = TTTGGATAGCGCTATCTCGT Site: position = -61 score = 6.55702 sequence = TTTGGATAGCGCTATCCTAG Gene: Lcho_0328: Gluconate utilization transcriptional regulator GntR, LacI family |
Gluconate utilization transcriptional regulator GntR, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |