Regulog GntR - Comamonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Phylum:	Proteobacteria/beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Statistics of regulated genes
Genome	Genes	Operons
Acidovorax avenae subsp. citrulli AAC00-1	5	2
Acidovorax sp. JS42	7	2
Comamonas testosteroni KF-1	7	2
Delftia acidovorans SPH-1	7	2
Polaromonas naphthalenivorans CJ2	5	2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236	2	2
Variovorax paradoxus S110	3	2
Verminephrobacter eiseniae EF01-2
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6	2	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
gntK	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -109 score = 6.07601 sequence = CTAGGATAGCGCTATCTTGC Gene: Aave_2797: Thermoresistant gluconokinase (EC 2.7.1.12)	* Acidovorax sp. JS42 Site: position = -180 score = 6.04656 sequence = TTAAGATAGCGCTATCTTTC Gene: Ajs_2053: Thermoresistant gluconokinase (EC 2.7.1.12)	* Comamonas testosteroni KF-1 Site: position = -21 score = 6.34252 sequence = ATCGGATAGCGCTATCCAAA Site: position = -147 score = 6.01302 sequence = TTATGATAGCGCTATCCGGA Gene: CtesDRAFT_0561: Thermoresistant gluconokinase (EC 2.7.1.12)	* Delftia acidovorans SPH-1 Site: position = -120 score = 6.27531 sequence = TTATGATAGCGCTATCCCAA Gene: Daci_3761: Thermoresistant gluconokinase (EC 2.7.1.12)	* Polaromonas naphthalenivorans CJ2 Site: position = -140 score = 6.46716 sequence = ATAGGATAGCGCTATCCCAA Site: position = -30 score = 6.10489 sequence = AACGGATAGCGCTATCCAAG Gene: Pnap_0046: Thermoresistant gluconokinase (EC 2.7.1.12)	Polaromonas sp. JS666	* Rhodoferax ferrireducens DSM 15236 Site: position = -33 score = 6.05178 sequence = TTAAGATAGCGCTATCTATT Gene: Rfer_0956: Thermoresistant gluconokinase (EC 2.7.1.12)	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	* Leptothrix cholodnii SP-6 Site: position = -128 score = 6.55702 sequence = CTAGGATAGCGCTATCCAAA Site: position = -19 score = 6.01059 sequence = ACGAGATAGCGCTATCCAAA Gene: Lcho_0327: Thermoresistant gluconokinase (EC 2.7.1.12)	Thermoresistant gluconokinase (EC 2.7.1.12)
gntY	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2796: Predicted gluconate TRAP family transporter, DctQ subunit	Acidovorax sp. JS42 Gene: Ajs_2052: Predicted gluconate TRAP family transporter, DctQ subunit	Comamonas testosteroni KF-1 Gene: CtesDRAFT_0560: Predicted gluconate TRAP family transporter, DctQ subunit	Delftia acidovorans SPH-1 Gene: Daci_3762: Predicted gluconate TRAP family transporter, DctQ subunit	Polaromonas naphthalenivorans CJ2 Gene: Pnap_0045: Predicted gluconate TRAP family transporter, DctQ subunit	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Predicted gluconate TRAP family transporter, DctQ subunit
gntZ	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2795: Predicted gluconate TRAP family transporter, DctM subunit	Acidovorax sp. JS42 Gene: Ajs_2051: Predicted gluconate TRAP family transporter, DctM subunit	Comamonas testosteroni KF-1 Gene: CtesDRAFT_0559: Predicted gluconate TRAP family transporter, DctM subunit	Delftia acidovorans SPH-1 Gene: Daci_3763: Predicted gluconate TRAP family transporter, DctM subunit	Polaromonas naphthalenivorans CJ2 Gene: Pnap_0044: Predicted gluconate TRAP family transporter, DctM subunit	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Predicted gluconate TRAP family transporter, DctM subunit
gntX	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2794: Predicted gluconate TRAP family transporter, DctP subunit	Acidovorax sp. JS42 Gene: Ajs_2050: Predicted gluconate TRAP family transporter, DctP subunit	Comamonas testosteroni KF-1 Gene: CtesDRAFT_0558: Predicted gluconate TRAP family transporter, DctP subunit	Delftia acidovorans SPH-1 Gene: Daci_3764: Predicted gluconate TRAP family transporter, DctP subunit	Polaromonas naphthalenivorans CJ2 Gene: Pnap_0043: Predicted gluconate TRAP family transporter, DctP subunit	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Predicted gluconate TRAP family transporter, DctP subunit
edd	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2793: 6-phosphogluconate dehydratase (EC 4.2.1.12)	Acidovorax sp. JS42 Gene: Ajs_2049: 6-phosphogluconate dehydratase (EC 4.2.1.12)	Comamonas testosteroni KF-1 Gene: CtesDRAFT_0557: 6-phosphogluconate dehydratase (EC 4.2.1.12)	Delftia acidovorans SPH-1 Gene: Daci_3765: 6-phosphogluconate dehydratase (EC 4.2.1.12)	Polaromonas naphthalenivorans CJ2 Gene: Pnap_2986: 6-phosphogluconate dehydratase (EC 4.2.1.12)	Polaromonas sp. JS666 Gene: Bpro_3551: 6-phosphogluconate dehydratase (EC 4.2.1.12)	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2060: 6-phosphogluconate dehydratase (EC 4.2.1.12)	Variovorax paradoxus S110 Gene: Vapar_3708: 6-phosphogluconate dehydratase (EC 4.2.1.12)	Verminephrobacter eiseniae EF01-2 Gene: Veis_2570: 6-phosphogluconate dehydratase (EC 4.2.1.12)	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6 Gene: Lcho_2919: 6-phosphogluconate dehydratase (EC 4.2.1.12)	6-phosphogluconate dehydratase (EC 4.2.1.12)
eda	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2792: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)	Acidovorax sp. JS42 Gene: Ajs_2048: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)	Comamonas testosteroni KF-1 Gene: CtesDRAFT_0556: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)	Delftia acidovorans SPH-1 Gene: Daci_3766: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)	Polaromonas naphthalenivorans CJ2 Gene: Pnap_2985: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)	Polaromonas sp. JS666 Gene: Bpro_3550: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2061: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)	Variovorax paradoxus S110 Gene: Vapar_3707: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)	Verminephrobacter eiseniae EF01-2 Gene: Veis_2569: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6 Gene: Lcho_2918: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)	2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)

CRON 2.
gntT	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	* Variovorax paradoxus S110 Site: position = -66 score = 5.77646 sequence = GCGGGATAGCGCTATCCCTG Site: position = -141 score = 6.10389 sequence = CTAGGATAGCGCTGTCCCAG Site: position = -157 score = 5.7446 sequence = ATTGGACAGCGCTGTCCTAG Gene: Vapar_6142: High-affinity H+/gluconate symporter	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	High-affinity H+/gluconate symporter
gntK3	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_6143: Gluconokinase, Firmicutes type (EC 2.7.1.12)	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Gluconokinase, Firmicutes type (EC 2.7.1.12)

CRON 3.
gntR	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -55 score = 6.07601 sequence = GCAAGATAGCGCTATCCTAG Site: position = -172 score = 6.10489 sequence = CTTGGATAGCGCTATCCGTT Gene: Aave_2798: Gluconate utilization transcriptional regulator GntR, LacI family	* Acidovorax sp. JS42 Site: position = -55 score = 6.04656 sequence = GAAAGATAGCGCTATCTTAA Site: position = -219 score = 6.02303 sequence = TCAAGATAGCGCTATCTTTA Gene: Ajs_2054: Gluconate utilization transcriptional regulator GntR, LacI family	* Comamonas testosteroni KF-1 Site: position = -181 score = 6.34252 sequence = TTTGGATAGCGCTATCCGAT Site: position = -55 score = 6.01302 sequence = TCCGGATAGCGCTATCATAA Gene: CtesDRAFT_0562: Gluconate utilization transcriptional regulator GntR, LacI family	* Delftia acidovorans SPH-1 Site: position = -175 score = 6.24875 sequence = TTGGGATAGCGCTATCCATG Site: position = -56 score = 6.27531 sequence = TTGGGATAGCGCTATCATAA Gene: Daci_3760: Gluconate utilization transcriptional regulator GntR, LacI family	* Polaromonas naphthalenivorans CJ2 Site: position = -128 score = 6.10489 sequence = CTTGGATAGCGCTATCCGTT Gene: Pnap_0047: Gluconate utilization transcriptional regulator GntR, LacI family	Polaromonas sp. JS666	* Rhodoferax ferrireducens DSM 15236 Site: position = -197 score = 6.05178 sequence = AATAGATAGCGCTATCTTAA Gene: Rfer_0957: Gluconate utilization transcriptional regulator GntR, LacI family	* Variovorax paradoxus S110 Site: position = -70 score = 6.10389 sequence = CTGGGACAGCGCTATCCTAG Site: position = -54 score = 5.7446 sequence = CTAGGACAGCGCTGTCCAAT Site: position = -145 score = 5.77646 sequence = CAGGGATAGCGCTATCCCGC Gene: Vapar_6141: Gluconate utilization transcriptional regulator GntR, LacI family	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	* Leptothrix cholodnii SP-6 Site: position = -170 score = 6.01059 sequence = TTTGGATAGCGCTATCTCGT Site: position = -61 score = 6.55702 sequence = TTTGGATAGCGCTATCCTAG Gene: Lcho_0328: Gluconate utilization transcriptional regulator GntR, LacI family	Gluconate utilization transcriptional regulator GntR, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog GntR - Comamonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --