Regulon of GntR in Acidovorax avenae subsp. citrulli AAC00-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Aave_2798
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Comamonadaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -172 Score: 6.1 Sequence: CTTGGATAGCGCTATCCGTT Position: -55 Score: 6.1 Sequence: GCAAGATAGCGCTATCCTAG Locus tag: Aave_2798 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	Aave_2798	gntR	Gluconate utilization transcriptional regulator GntR, LacI family
Position: -109 Score: 6.1 Sequence: CTAGGATAGCGCTATCTTGC Locus tag: Aave_2797 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: Aave_2796 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: Aave_2795 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: Aave_2794 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit
	Aave_2797	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
	Aave_2796	gntY	Predicted gluconate TRAP family transporter, DctQ subunit
	Aave_2795	gntZ	Predicted gluconate TRAP family transporter, DctM subunit
	Aave_2794	gntX	Predicted gluconate TRAP family transporter, DctP subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD