Regulon of GntR in Leptothrix cholodnii SP-6

Properties
Regulator type:	Transcription factor
TF locus tag:	Lcho_0328
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Comamonadaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -170 Score: 6 Sequence: TTTGGATAGCGCTATCTCGT Position: -61 Score: 6.6 Sequence: TTTGGATAGCGCTATCCTAG Locus tag: Lcho_0328 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	Lcho_0328	gntR	Gluconate utilization transcriptional regulator GntR, LacI family
Position: -128 Score: 6.6 Sequence: CTAGGATAGCGCTATCCAAA Position: -19 Score: 6 Sequence: ACGAGATAGCGCTATCCAAA Locus tag: Lcho_0327 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
	Lcho_0327	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD