Regulon of GntR in Polaromonas naphthalenivorans CJ2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pnap_0047
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Comamonadaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -140 Score: 6.5 Sequence: ATAGGATAGCGCTATCCCAA Position: -30 Score: 6.1 Sequence: AACGGATAGCGCTATCCAAG Locus tag: Pnap_0046 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: Pnap_0045 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: Pnap_0044 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: Pnap_0043 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit
	Pnap_0046	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
	Pnap_0045	gntY	Predicted gluconate TRAP family transporter, DctQ subunit
	Pnap_0044	gntZ	Predicted gluconate TRAP family transporter, DctM subunit
	Pnap_0043	gntX	Predicted gluconate TRAP family transporter, DctP subunit
Position: -128 Score: 6.1 Sequence: CTTGGATAGCGCTATCCGTT Locus tag: Pnap_0047 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	Pnap_0047	gntR	Gluconate utilization transcriptional regulator GntR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD