Regulon of GntR in Delftia acidovorans SPH-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Daci_3760
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Comamonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -175 Score: 6.2 Sequence: TTGGGATAGCGCTATCCATG Position: -56 Score: 6.3 Sequence: TTGGGATAGCGCTATCATAA Locus tag: Daci_3760 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	Daci_3760	gntR	Gluconate utilization transcriptional regulator GntR, LacI family
Position: -120 Score: 6.3 Sequence: TTATGATAGCGCTATCCCAA Locus tag: Daci_3761 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: Daci_3762 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: Daci_3763 Name: gntZ Funciton: Predicted gluconate TRAP family transporter, DctM subunit Locus tag: Daci_3764 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit Locus tag: Daci_3765 Name: edd Funciton: 6-phosphogluconate dehydratase (EC 4.2.1.12) Locus tag: Daci_3766 Name: eda Funciton: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
	Daci_3761	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
	Daci_3762	gntY	Predicted gluconate TRAP family transporter, DctQ subunit
	Daci_3763	gntZ	Predicted gluconate TRAP family transporter, DctM subunit
	Daci_3764	gntX	Predicted gluconate TRAP family transporter, DctP subunit
	Daci_3765	edd	6-phosphogluconate dehydratase (EC 4.2.1.12)
	Daci_3766	eda	2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD