Regulon of GntR in Rhodoferax ferrireducens DSM 15236

Properties
Regulator type:	Transcription factor
TF locus tag:	Rfer_0957
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Comamonadaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -197 Score: 6.1 Sequence: AATAGATAGCGCTATCTTAA Locus tag: Rfer_0957 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	Rfer_0957	gntR	Gluconate utilization transcriptional regulator GntR, LacI family
Position: -33 Score: 6.1 Sequence: TTAAGATAGCGCTATCTATT Locus tag: Rfer_0956 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
	Rfer_0956	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD