Regulog GntR - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By trascription factor - GntR
- By TF family - LacI
- By effector - Gluconate
- By pathway - Gluconate utilization
| Genome | Genes | Operons |
|---|---|---|
| Pseudomonas aeruginosa PAO1 | 3 | 3 |
| Pseudomonas entomophila L48 | 3 | 3 |
| Pseudomonas putida KT2440 | 3 | 3 |
| Pseudomonas syringae pv. tomato str. DC3000 | 3 | 3 |
| Pseudomonas fluorescens Pf-5 | 3 | 3 |
| Pseudomonas mendocina ymp | 4 | 1 |
| Pseudomonas stutzeri A1501 | 4 | 1 |
| Azotobacter vinelandii AvOP | 4 | 4 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| gntKZ |
|
|
|
|
|
*
Pseudomonas mendocina ymp Site: position = -67 score = 4.52842 sequence = TTTGGATAGCGCTAACATCC Gene: Pmen_2569: Thermoresistant gluconokinase (EC 2.7.1.12) / Predicted gluconate TRAP family transporter DctM subunit fusion |
*
Pseudomonas stutzeri A1501 Site: position = -104 score = 4.46828 sequence = GTTTGATAGCGCTAACATCC Gene: PST_2201: Thermoresistant gluconokinase (EC 2.7.1.12) / Predicted gluconate TRAP family transporter DctM subunit fusion |
|
Thermoresistant gluconokinase (EC 2.7.1.12) / Predicted gluconate TRAP family transporter DctM subunit fusion |
| gntY |
|
|
|
|
|
Gene: Pmen_2568: Predicted gluconate TRAP family transporter, DctQ subunit |
Gene: PST_2200: Predicted gluconate TRAP family transporter, DctQ subunit |
|
Predicted gluconate TRAP family transporter, DctQ subunit |
| gntX |
|
|
|
|
|
Gene: Pmen_2567: Predicted gluconate TRAP family transporter, DctP subunit |
Gene: PST_2199: Predicted gluconate TRAP family transporter, DctP subunit |
|
Predicted gluconate TRAP family transporter, DctP subunit |
| gntR |
*
Pseudomonas aeruginosa PAO1 Site: position = -52 score = 5.85537 sequence = GCGAGACAGCGCTACCTTAG Site: position = -180 score = 6.02369 sequence = GTGAGACAGCGCTATCTTTG Gene: PA2320: Gluconate utilization transcriptional regulator GntR, LacI family |
*
Pseudomonas entomophila L48 Site: position = -192 score = 6.03374 sequence = GTGAGATAGCGCTGTCTTGG Site: position = -62 score = 5.98969 sequence = CTGAGACAGCGCTACCTTAG Gene: PSEEN2422: Gluconate utilization transcriptional regulator GntR, LacI family |
*
Pseudomonas putida KT2440 Site: position = -191 score = 5.88748 sequence = GTGAGATAGCGCTGTCTCGC Site: position = -62 score = 5.98969 sequence = CTGAGACAGCGCTACCTTAG Gene: PP3415: Gluconate utilization transcriptional regulator GntR, LacI family |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -229 score = 5.76186 sequence = TGGAGACAGCGCTGTCTTTG Site: position = -65 score = 5.7255 sequence = ATGAGACAGCGCTACCTTAT Gene: PSPTO3563: Gluconate utilization transcriptional regulator GntR, LacI family |
*
Pseudomonas fluorescens Pf-5 Site: position = -201 score = 5.47468 sequence = CGCAGACAGCGCTACCTTCG Site: position = -50 score = 5.6091 sequence = TCAGGACAGCGCTACCTTAG Gene: PFL_4581: Gluconate utilization transcriptional regulator GntR, LacI family |
Gene: Pmen_2566: Gluconate utilization transcriptional regulator GntR, LacI family |
Gene: PST_2198: Gluconate utilization transcriptional regulator GntR, LacI family |
*
Azotobacter vinelandii AvOP Site: position = -167 score = 5.45706 sequence = CGAGGACAGCGCTATCCTGT Gene: Avin_27300: Gluconate utilization transcriptional regulator GntR, LacI family |
Gluconate utilization transcriptional regulator GntR, LacI family |
| gntK |
*
Pseudomonas aeruginosa PAO1 Site: position = -34 score = 6.02369 sequence = CAAAGATAGCGCTGTCTCAC Site: position = -162 score = 5.85537 sequence = CTAAGGTAGCGCTGTCTCGC Gene: PA2321: Thermoresistant gluconokinase (EC 2.7.1.12) |
*
Pseudomonas entomophila L48 Site: position = -166 score = 5.98969 sequence = CTAAGGTAGCGCTGTCTCAG Site: position = -36 score = 6.03374 sequence = CCAAGACAGCGCTATCTCAC Gene: PSEEN2421: Thermoresistant gluconokinase (EC 2.7.1.12) |
*
Pseudomonas putida KT2440 Site: position = -164 score = 5.98969 sequence = CTAAGGTAGCGCTGTCTCAG Site: position = -35 score = 5.88748 sequence = GCGAGACAGCGCTATCTCAC Gene: PP3416: Thermoresistant gluconokinase (EC 2.7.1.12) |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -238 score = 5.7255 sequence = ATAAGGTAGCGCTGTCTCAT Site: position = -74 score = 5.76186 sequence = CAAAGACAGCGCTGTCTCCA Gene: PSPTO3564: Thermoresistant gluconokinase (EC 2.7.1.12) |
*
Pseudomonas fluorescens Pf-5 Site: position = -185 score = 5.6091 sequence = CTAAGGTAGCGCTGTCCTGA Site: position = -34 score = 5.47468 sequence = CGAAGGTAGCGCTGTCTGCG Gene: PFL_4580: Thermoresistant gluconokinase (EC 2.7.1.12) |
|
|
*2
Azotobacter vinelandii AvOP Site: position = -177 score = 5.45706 sequence = ACAGGATAGCGCTGTCCTCG Gene: Avin_27310: Thermoresistant gluconokinase (EC 2.7.1.12) Site: position = -30 score = 5.53074 sequence = AAAAGATAGCGCTATCTACC Site: position = -176 score = 5.87755 sequence = ATAAGATAGCGCTGTCTTTA Gene: Avin_22480: Thermoresistant gluconokinase (EC 2.7.1.12) |
Thermoresistant gluconokinase (EC 2.7.1.12) |
| CRON 2. | |||||||||
| gntT |
*
Pseudomonas aeruginosa PAO1 Site: position = -78 score = 5.45145 sequence = CAAAGATAGCGCTACCCCGA Gene: PA2322: High-affinity H+/gluconate symporter |
*
Pseudomonas entomophila L48 Site: position = -82 score = 5.98191 sequence = CAAAGACAGCGCTGTCTTAA Gene: PSEEN2420: High-affinity H+/gluconate symporter |
*
Pseudomonas putida KT2440 Site: position = -88 score = 5.50541 sequence = CAAAGACAGCGCTACCCCAA Gene: PP3417: High-affinity H+/gluconate symporter |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -82 score = 5.87579 sequence = AAAAGACAGCGCTGTCTTGC Gene: PSPTO3565: High-affinity H+/gluconate symporter |
*
Pseudomonas fluorescens Pf-5 Site: position = -72 score = 5.50875 sequence = AAAAGGTAGCGCTATCCCAC Gene: PFL_4579: High-affinity H+/gluconate symporter |
|
|
*
Azotobacter vinelandii AvOP Site: position = -57 score = 5.88937 sequence = GAAAGATAGCGCTGTCTCGC Gene: Avin_22470: High-affinity H+/gluconate symporter |
High-affinity H+/gluconate symporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |