Regulon of GntR in Pseudomonas putida KT2440

Properties
Regulator type:	Transcription factor
TF locus tag:	PP3415
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -191 Score: 5.9 Sequence: GTGAGATAGCGCTGTCTCGC Position: -62 Score: 6 Sequence: CTGAGACAGCGCTACCTTAG Locus tag: PP3415 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	PP3415	gntR	Gluconate utilization transcriptional regulator GntR, LacI family
Position: -88 Score: 5.5 Sequence: CAAAGACAGCGCTACCCCAA Locus tag: PP3417 Name: gntT Funciton: High-affinity H+/gluconate symporter
	PP3417	gntT	High-affinity H+/gluconate symporter
Position: -164 Score: 6 Sequence: CTAAGGTAGCGCTGTCTCAG Position: -35 Score: 5.9 Sequence: GCGAGACAGCGCTATCTCAC Locus tag: PP3416 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
	PP3416	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD