Regulon of GntR in Pseudomonas stutzeri A1501

Properties
Regulator type:	Transcription factor
TF locus tag:	PST_2198
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 4.5 Sequence: GTTTGATAGCGCTAACATCC Locus tag: PST_2201 Name: gntKZ Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) / Predicted gluconate TRAP family transporter DctM subunit fusion Locus tag: PST_2200 Name: gntY Funciton: Predicted gluconate TRAP family transporter, DctQ subunit Locus tag: PST_2199 Name: gntX Funciton: Predicted gluconate TRAP family transporter, DctP subunit Locus tag: PST_2198 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	PST_2201	gntKZ	Thermoresistant gluconokinase (EC 2.7.1.12) / Predicted gluconate TRAP family transporter DctM subunit fusion
	PST_2200	gntY	Predicted gluconate TRAP family transporter, DctQ subunit
	PST_2199	gntX	Predicted gluconate TRAP family transporter, DctP subunit
	PST_2198	gntR	Gluconate utilization transcriptional regulator GntR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD