Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing gntKZ gene

Properties
Regulog: GntR - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/gamma
Built upon 32 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudomonas mendocina ymp
Position: -67
Score: 4.52842
Sequence: TTTGGATAGCGCTAACATCC
Locus tag: Pmen_2569
Name: gntKZ
Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) / Predicted gluconate TRAP family transporter DctM subunit fusion
Locus tag: Pmen_2568
Name: gntY
Funciton: Predicted gluconate TRAP family transporter, DctQ subunit
Locus tag: Pmen_2567
Name: gntX
Funciton: Predicted gluconate TRAP family transporter, DctP subunit
Locus tag: Pmen_2566
Name: gntR
Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
gntKZ-gntY-gntX-gntR -67 4.5 TTTGGATAGCGCTAACATCC Pmen_2569
Pseudomonas stutzeri A1501
Position: -104
Score: 4.46828
Sequence: GTTTGATAGCGCTAACATCC
Locus tag: PST_2201
Name: gntKZ
Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) / Predicted gluconate TRAP family transporter DctM subunit fusion
Locus tag: PST_2200
Name: gntY
Funciton: Predicted gluconate TRAP family transporter, DctQ subunit
Locus tag: PST_2199
Name: gntX
Funciton: Predicted gluconate TRAP family transporter, DctP subunit
Locus tag: PST_2198
Name: gntR
Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
gntKZ-gntY-gntX-gntR -104 4.5 GTTTGATAGCGCTAACATCC PST_2201