Regulon of GntR in Azotobacter vinelandii AvOP

Properties
Regulator type:	Transcription factor
TF locus tag:	Avin_27300
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 5.9 Sequence: GAAAGATAGCGCTGTCTCGC Locus tag: Avin_22470 Name: gntT Funciton: High-affinity H+/gluconate symporter
	Avin_22470	gntT	High-affinity H+/gluconate symporter
Position: -167 Score: 5.5 Sequence: CGAGGACAGCGCTATCCTGT Locus tag: Avin_27300 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	Avin_27300	gntR	Gluconate utilization transcriptional regulator GntR, LacI family
Position: -177 Score: 5.5 Sequence: ACAGGATAGCGCTGTCCTCG Locus tag: Avin_27310 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
	Avin_27310	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
Position: -176 Score: 5.9 Sequence: ATAAGATAGCGCTGTCTTTA Position: -30 Score: 5.5 Sequence: AAAAGATAGCGCTATCTACC Locus tag: Avin_22480 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
	Avin_22480	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD