Regulon of GntR in Pseudomonas syringae pv. tomato str. DC3000

Properties
Regulator type:	Transcription factor
TF locus tag:	PSPTO3563
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -82 Score: 5.9 Sequence: AAAAGACAGCGCTGTCTTGC Locus tag: PSPTO3565 Name: gntT Funciton: High-affinity H+/gluconate symporter
	PSPTO3565	gntT	High-affinity H+/gluconate symporter
Position: -238 Score: 5.7 Sequence: ATAAGGTAGCGCTGTCTCAT Position: -74 Score: 5.8 Sequence: CAAAGACAGCGCTGTCTCCA Locus tag: PSPTO3564 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
	PSPTO3564	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
Position: -229 Score: 5.8 Sequence: TGGAGACAGCGCTGTCTTTG Position: -65 Score: 5.7 Sequence: ATGAGACAGCGCTACCTTAT Locus tag: PSPTO3563 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	PSPTO3563	gntR	Gluconate utilization transcriptional regulator GntR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD