Regulog Zur - Mycobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Mycobacteriaceae
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Mycobacterium abscessus ATCC 19977 | 11 | 4 |
| Mycobacterium avium 104 | 11 | 6 |
| Mycobacterium flavescens PYR-GCK | 9 | 4 |
| Mycobacterium leprae TN | 4 | 1 |
| Mycobacterium marinum M | 22 | 5 |
| Mycobacterium smegmatis str. MC2 155 | 15 | 6 |
| Mycobacterium sp. JLS | 14 | 6 |
| Mycobacterium tuberculosis H37Rv | 21 | 6 |
| Mycobacterium vanbaalenii PYR-1 | 18 | 9 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| yciC3 |
|
*
Mycobacterium avium 104 Site: position = -81 score = 5.54983 sequence = AGATGAAAACGATTACCAATA Site: position = -136 score = 5.80851 sequence = TATTGAAAATCATTTTCGACA Gene: MAV_4874: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
*
Mycobacterium flavescens PYR-GCK Site: position = -87 score = 5.80851 sequence = TATTGAAAATCATTTTCGACA Site: position = -32 score = 5.30713 sequence = TATTGAAGATCATTCCCATTA Gene: Mflv_1313: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
|
|
|
*
Mycobacterium vanbaalenii PYR-1 Site: position = -90 score = 5.54213 sequence = TATTGGAAATCGTTTTCGACA Site: position = -35 score = 5.79585 sequence = TATTGGAAATCATTCCCATTA Gene: Mvan_5488: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
| CRON 2. | ||||||||||
| Rv0282 |
Gene: MAB_2234c: Conserved hypothetical protein (AAA ATPase?) |
*
Mycobacterium avium 104 Site: position = -232 score = 6.21615 sequence = TAATGAAAATGATTTTCAGTA Gene: MAV_4871: Conserved hypothetical protein (AAA ATPase?) |
Gene: Mflv_0329: Conserved hypothetical protein (AAA ATPase?) |
*
Mycobacterium leprae TN Site: position = -153 score = 4.8334 sequence = ATATGATAATCGTATTCAGTA Gene: ML2537: Conserved hypothetical protein (AAA ATPase?) |
*
Mycobacterium marinum M Site: position = -265 score = 5.61682 sequence = TAATGAAAATCATGTTCACTA Gene: MMAR_0541: Conserved hypothetical protein (AAA ATPase?) |
Gene: MSMEG_0615: Conserved hypothetical protein (AAA ATPase?) |
Gene: Mjls_0359: Conserved hypothetical protein (AAA ATPase?) |
*
Mycobacterium tuberculosis H37Rv Site: position = -186 score = 5.66883 sequence = TAATGAAAATCATGTTCAGTA Gene: Rv0282: Conserved hypothetical protein (AAA ATPase?) |
Gene: Mvan_0411: Conserved hypothetical protein (AAA ATPase?) |
Conserved hypothetical protein (AAA ATPase?) |
| Rv0283 |
Gene: MAB_2233c: hypothetical protein Rv0283 |
Gene: MAV_4870: hypothetical protein Rv0283 |
Gene: Mflv_0328: hypothetical protein Rv0283 |
Gene: ML2536: hypothetical protein Rv0283 |
Gene: MMAR_0542: hypothetical protein Rv0283 |
Gene: MSMEG_0616: hypothetical protein Rv0283 |
Gene: Mjls_0360: hypothetical protein Rv0283 |
Gene: Rv0283: hypothetical protein Rv0283 |
Gene: Mvan_0412: hypothetical protein Rv0283 |
hypothetical protein Rv0283 |
| Rv0284 |
Gene: MAB_2232c: conserved hypothetical protein |
|
Gene: Mflv_0327: conserved hypothetical protein |
Gene: ML2535: conserved hypothetical protein |
Gene: MMAR_0543: conserved hypothetical protein |
Gene: MSMEG_0617: conserved hypothetical protein |
Gene: Mjls_0361: conserved hypothetical protein |
Gene: Rv0284: conserved hypothetical protein |
Gene: Mvan_0413: conserved hypothetical protein |
conserved hypothetical protein |
| Rv0285 |
Gene: MAB_2231c: PE domain-containing protein |
Gene: MAV_4868: PE domain-containing protein |
Gene: Mflv_0326: PE domain-containing protein |
Gene: ML2534: PE domain-containing protein |
Gene: MMAR_0544: PE domain-containing protein |
Gene: MSMEG_0618: PE domain-containing protein |
Gene: Mjls_0362: PE domain-containing protein |
Gene: Rv0285: PE domain-containing protein |
Gene: Mvan_0414: PE domain-containing protein |
PE domain-containing protein |
| Rv0286 |
Gene: MAB_2230c: PPE protein |
Gene: MAV_4867: PPE protein |
Gene: Mflv_0325: PPE protein |
|
Gene: MMAR_0545: PPE protein |
Gene: MSMEG_0619: PPE protein |
Gene: Mjls_0363: PPE protein |
Gene: Rv0286: PPE protein |
Gene: Mvan_0415: PPE protein |
PPE protein |
| Rv0287 |
Gene: MAB_2229c: PE family protein |
Gene: MAV_4866: PE family protein |
Gene: Mflv_0324: PE family protein |
|
Gene: MMAR_0546: PE family protein |
Gene: MSMEG_0620: PE family protein |
Gene: Mjls_0364: PE family protein |
Gene: Rv0287: PE family protein |
Gene: Mvan_0417: PE family protein |
PE family protein |
| Rv0288 |
Gene: MAB_2228c: hypothetical protein Rv0288 |
Gene: MAV_4865: hypothetical protein Rv0288 |
Gene: Mflv_0323: hypothetical protein Rv0288 |
|
Gene: MMAR_0547: hypothetical protein Rv0288 |
Gene: MSMEG_0621: hypothetical protein Rv0288 |
Gene: Mjls_0365: hypothetical protein Rv0288 |
Gene: Rv0288: hypothetical protein Rv0288 |
Gene: Mvan_0418: hypothetical protein Rv0288 |
hypothetical protein Rv0288 |
| Rv0289 |
Gene: MAB_2227c: hypothetical protein Rv0289 |
Gene: MAV_4864: hypothetical protein Rv0289 |
Gene: Mflv_0322: hypothetical protein Rv0289 |
Gene: ML2530: hypothetical protein Rv0289 |
Gene: MMAR_0548: hypothetical protein Rv0289 |
Gene: MSMEG_0622: hypothetical protein Rv0289 |
Gene: Mjls_0366: hypothetical protein Rv0289 |
Gene: Rv0289: hypothetical protein Rv0289 |
Gene: Mvan_0419: hypothetical protein Rv0289 |
hypothetical protein Rv0289 |
| Rv0290 |
Gene: MAB_2226c: hypothetical protein Rv0290 |
Gene: MAV_4863: hypothetical protein Rv0290 |
Gene: Mflv_0321: hypothetical protein Rv0290 |
Gene: ML2529: hypothetical protein Rv0290 |
Gene: MMAR_0549: hypothetical protein Rv0290 |
Gene: MSMEG_0623: hypothetical protein Rv0290 |
Gene: Mjls_0367: hypothetical protein Rv0290 |
Gene: Rv0290: hypothetical protein Rv0290 |
Gene: Mvan_0420: hypothetical protein Rv0290 |
hypothetical protein Rv0290 |
| Rv0291 |
Gene: MAB_2225c: Extracellular subtilisin-like protease precursor (EC 3.4.21.-) |
Gene: MAV_4862: Extracellular subtilisin-like protease precursor (EC 3.4.21.-) |
Gene: Mflv_0320: Extracellular subtilisin-like protease precursor (EC 3.4.21.-) |
Gene: ML2528: Extracellular subtilisin-like protease precursor (EC 3.4.21.-) |
Gene: MMAR_0550: Extracellular subtilisin-like protease precursor (EC 3.4.21.-) |
Gene: MSMEG_0624: Extracellular subtilisin-like protease precursor (EC 3.4.21.-) |
Gene: Mjls_0368: Extracellular subtilisin-like protease precursor (EC 3.4.21.-) |
Gene: Rv0291: Extracellular subtilisin-like protease precursor (EC 3.4.21.-) |
Gene: Mvan_0421: Extracellular subtilisin-like protease precursor (EC 3.4.21.-) |
Extracellular subtilisin-like protease precursor (EC 3.4.21.-) |
| Rv0292 |
Gene: MAB_2224c: hypothetical protein Rv0292 |
Gene: MAV_4860: hypothetical protein Rv0292 |
Gene: Mflv_0319: hypothetical protein Rv0292 |
Gene: ML2527: hypothetical protein Rv0292 |
Gene: MMAR_0551: hypothetical protein Rv0292 |
Gene: MSMEG_0626: hypothetical protein Rv0292 |
Gene: Mjls_0369: hypothetical protein Rv0292 |
Gene: Rv0292: hypothetical protein Rv0292 |
Gene: Mvan_0422: hypothetical protein Rv0292 |
hypothetical protein Rv0292 |
| CRON 3. | ||||||||||
| znuA |
*
Mycobacterium abscessus ATCC 19977 Site: position = -43 score = 6.45345 sequence = TAATGAAAATCGTTTTCATTA Gene: MAB_0577c: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Mycobacterium avium 104 Site: position = -63 score = 6.25081 sequence = TAATGGAAACGATTTTCATTA Gene: MAV_0583: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Mycobacterium flavescens PYR-GCK Site: position = -2 score = 5.28781 sequence = TAATGAAAACGGTTATCGTAT Gene: Mflv_1454: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: ML0337: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Mycobacterium marinum M Site: position = -32 score = 6.05626 sequence = TAATGGAAACGGTTGTCATTA Gene: MMAR_5071: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Mycobacterium smegmatis str. MC2 155 Site: position = -90 score = 6.09939 sequence = TATCGAAAATGATTTTCAATA Site: position = -44 score = 5.34837 sequence = TAATGCAAACGGTTATCGTTA Gene: MSMEG_6047: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Mycobacterium sp. JLS Site: position = -88 score = 5.53056 sequence = AAATGCAAACCGTTATCATTA Gene: Mjls_5104: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Mycobacterium tuberculosis H37Rv Site: position = -85 score = 5.80851 sequence = TATTGAAAATCATTTTCGACA Site: position = -30 score = 5.55538 sequence = TAATGAAAACTGTTATCGATA Gene: Rv2059: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Mycobacterium vanbaalenii PYR-1 Site: position = -81 score = 6.31201 sequence = TAATGATAATCATTTTCAATA Site: position = -25 score = 5.24684 sequence = TAATGAAAACGGTTATCGTTG Gene: Mvan_5320: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| znuC |
Gene: MAB_0576c: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: MAV_0582: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Mflv_1455: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: ML0336: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: MMAR_5072: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: MSMEG_6046: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Mjls_5103: Zinc ABC transporter, ATP-binding protein ZnuC |
|
Gene: Mvan_5319: Zinc ABC transporter, ATP-binding protein ZnuC |
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB |
Gene: MAB_0575c: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: MAV_0581: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Mflv_1456: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: ML0335: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: MMAR_5073: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: MSMEG_6045: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Mjls_5102: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Rv2060: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Mvan_5318: Zinc ABC transporter, inner membrane permease protein ZnuB |
Zinc ABC transporter, inner membrane permease protein ZnuB |
| lamB |
Gene: MAB_0574c: Conserved hypothetical protein (LamB/YcsF) |
Gene: MAV_0580: Conserved hypothetical protein (LamB/YcsF) |
Gene: Mflv_1451: Conserved hypothetical protein (LamB/YcsF) |
Gene: ML0333: Conserved hypothetical protein (LamB/YcsF) |
|
Gene: MSMEG_6054: Conserved hypothetical protein (LamB/YcsF) |
Gene: Mjls_5112: Conserved hypothetical protein (LamB/YcsF) |
|
Gene: Mvan_5327: Conserved hypothetical protein (LamB/YcsF) |
Conserved hypothetical protein (LamB/YcsF) |
| znuC2 |
|
|
|
|
|
*
Mycobacterium smegmatis str. MC2 155 Site: position = -31 score = 5.92825 sequence = TAATGATAATCGTTTTCAAAA Gene: MSMEG_6052: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Mycobacterium sp. JLS Site: position = -2 score = 6.21096 sequence = TAATGAAAATCATTTTCAACA Gene: Mjls_5111: Zinc ABC transporter, ATP-binding protein ZnuC |
|
*
Mycobacterium vanbaalenii PYR-1 Site: position = -2 score = 6.37103 sequence = TAATGACAATCATTTTCAATA Gene: Mvan_5326: Zinc ABC transporter, ATP-binding protein ZnuC |
Zinc ABC transporter, ATP-binding protein ZnuC |
| bluB |
|
|
|
|
|
Gene: MSMEG_6053: Cobalamin biosynthesis protein BluB @ 5,6-dimethylbenzimidazole synthase, flavin destructase family |
|
|
|
Putative nitroreductase |
| yciC |
*
Mycobacterium abscessus ATCC 19977 Site: position = -106 score = 5.32049 sequence = TAATGGGAATCATTTTCGACA Site: position = -51 score = 5.78413 sequence = TAATGAAAATCGTTTGCATTT Gene: MAB_0335: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
|
*
Mycobacterium marinum M Site: position = -51 score = 6.43811 sequence = TAATGAAAATCGTTTTCAATA Site: position = -107 score = 5.80851 sequence = TATTGAAAATCATTTTCGACA Gene: MMAR_0293: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
*
Mycobacterium smegmatis str. MC2 155 Site: position = -54 score = 6.3073 sequence = TAATGACAATCGTTTTCAATA Gene: MSMEG_6069: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
*
Mycobacterium sp. JLS Site: position = -88 score = 5.74477 sequence = TATTGAAAACCATTTTCGACA Site: position = -33 score = 5.70036 sequence = TATTGACAATCGTTCTCAACA Gene: Mjls_5117: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
*
Mycobacterium tuberculosis H37Rv Site: position = -31 score = 6.16839 sequence = TAATGGCAATCATTTTCAATA Site: position = -85 score = 5.21184 sequence = TGTTGAAAATAGTTTTCGACA Gene: Rv0106: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
*
Mycobacterium vanbaalenii PYR-1 Site: position = -31 score = 5.92742 sequence = TAATGGAAATGATTTTCGTTA Gene: Mvan_5332: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
| rpmE2 |
Gene: MAB_0336: 50S ribosomal protein L31 |
|
|
|
Gene: MMAR_0294: 50S ribosomal protein L31 |
Gene: MSMEG_6070: 50S ribosomal protein L31 |
|
|
*
Mycobacterium vanbaalenii PYR-1 Site: position = -40 score = 6.23547 sequence = TAATGGAAATGGTTTTCAATA Gene: Mvan_5333: 50S ribosomal protein L31 |
50S ribosomal protein L31 |
| CRON 4. | ||||||||||
| znuB2 |
|
|
|
|
|
|
*2
Mycobacterium sp. JLS Gene: Mjls_5109: Zinc ABC transporter, inner membrane permease protein ZnuB Site: position = -90 score = 6.21096 sequence = TGTTGAAAATGATTTTCATTA Gene: Mjls_5110: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
*
Mycobacterium vanbaalenii PYR-1 Site: position = -39 score = 6.37103 sequence = TATTGAAAATGATTGTCATTA Gene: Mvan_5325: Zinc ABC transporter, inner membrane permease protein ZnuB |
Zinc ABC transporter, inner membrane permease protein ZnuB |
| znuA2 |
|
|
|
|
|
Gene: MSMEG_6050: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: Mjls_5108: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
Gene: Mvan_5324: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| Mflv_3560 |
|
|
*
Mycobacterium flavescens PYR-GCK Site: position = -39 score = 6.051 sequence = TTTTGACAATGATTTTCATTA Gene: Mflv_3560: putative secreted protein |
|
|
Gene: MSMEG_6049: putative secreted protein |
Gene: Mjls_5107: putative secreted protein |
|
Gene: Mvan_5323: putative secreted protein |
putative secreted protein |
| CRON 5. | ||||||||||
| yciC2 |
*
Mycobacterium abscessus ATCC 19977 Site: position = -19 score = 4.69736 sequence = TAATGGTTATCATTATCATGT Site: position = -25 score = 6.07378 sequence = TAATGATAATGGTTATCATTA Gene: MAB_1046c: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
|
|
*
Mycobacterium smegmatis str. MC2 155 Site: position = -76 score = 5.34837 sequence = TAACGATAACCGTTTGCATTA Site: position = -30 score = 6.09939 sequence = TATTGAAAATCATTTTCGATA Gene: MSMEG_6048: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
*
Mycobacterium vanbaalenii PYR-1 Site: position = -8 score = 6.31201 sequence = TATTGAAAATGATTATCATTA Site: position = -64 score = 5.24684 sequence = CAACGATAACCGTTTTCATTA Gene: Mvan_5321: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
| CRON 6. | ||||||||||
| znr |
Gene: MAB_1679c: Zinc homeostasis transcriptional regulator Znr, ArsR family |
Gene: MAV_2037: Zinc homeostasis transcriptional regulator Znr, ArsR family |
Gene: Mflv_2718: Zinc homeostasis transcriptional regulator Znr, ArsR family |
Gene: ML0825: Zinc homeostasis transcriptional regulator Znr, ArsR family |
Gene: MMAR_3668: Zinc homeostasis transcriptional regulator Znr, ArsR family |
*
Mycobacterium smegmatis str. MC2 155 Site: position = -20 score = 6.03054 sequence = TAATGAAAACGATTTCCAATT Gene: MSMEG_4486: Zinc homeostasis transcriptional regulator Znr, ArsR family |
*
Mycobacterium sp. JLS Site: position = -2 score = 5.65889 sequence = TAATGAAAATCGTTTCCAGCA Gene: Mjls_3457: Zinc homeostasis transcriptional regulator Znr, ArsR family |
Gene: Rv2358: Zinc homeostasis transcriptional regulator Znr, ArsR family |
*
Mycobacterium vanbaalenii PYR-1 Site: position = -2 score = 5.88604 sequence = TAATGAAAACGGTTTCCAGTA Gene: Mvan_3819: Zinc homeostasis transcriptional regulator Znr, ArsR family |
Zinc homeostasis transcriptional regulator Znr, ArsR family |
| zur |
Gene: MAB_1678c: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: MAV_2036: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: Mflv_2717: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: ML0824: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: MMAR_3669: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: MSMEG_4487: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: Mjls_3458: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: Rv2359: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: Mvan_3820: Zinc homeostasis transcriptional regulator Zur, Fur family |
Zinc homeostasis transcriptional regulator Zur, Fur family |
| CRON 7. | ||||||||||
| ppe3 |
|
*2
Mycobacterium avium 104 Site: position = -69 score = 4.39248 sequence = GGTTGATAACGATAATCATTT Site: position = -63 score = 5.94023 sequence = TAACGATAATCATTTTCATTA Gene: MAV_4879: PPE family protein, PPE3 Site: position = -71 score = 4.67271 sequence = TGCTGATAACGATAATCATTT Site: position = -65 score = 5.38226 sequence = TAACGATAATCATTTTCACTT Gene: MAV_4349: PPE family protein, PPE3 |
|
|
*
Mycobacterium marinum M Site: position = -36 score = 5.28633 sequence = TAATGACAATCATATTCATCT Gene: MMAR_0538: PPE family protein, PPE3 |
|
|
*
Mycobacterium tuberculosis H37Rv Site: position = -43 score = 5.67898 sequence = TAATGAAAATCATGTTCATCA Gene: Rv0280: PPE family protein, PPE3 |
|
PPE family protein, PPE3 |
| Rv0281 |
|
|
|
|
Gene: MMAR_0539: hypothetical protein Rv0281 |
|
|
Gene: Rv0281: hypothetical protein Rv0281 |
|
hypothetical protein Rv0281 |
| CRON 8. | ||||||||||
| rpmB1 |
*
Mycobacterium abscessus ATCC 19977 Site: position = -35 score = 5.32049 sequence = TGTCGAAAATGATTCCCATTA Site: position = -90 score = 5.78413 sequence = AAATGCAAACGATTTTCATTA Gene: MAB_0334c: 50S ribosomal protein L28 |
*
Mycobacterium avium 104 Site: position = -38 score = 5.80851 sequence = TGTCGAAAATGATTTTCAATA Site: position = -93 score = 5.54983 sequence = TATTGGTAATCGTTTTCATCT Gene: MAV_4875: 50S ribosomal protein L28 |
*
Mycobacterium flavescens PYR-GCK Site: position = -99 score = 5.30713 sequence = TAATGGGAATGATCTTCAATA Site: position = -44 score = 5.80851 sequence = TGTCGAAAATGATTTTCAATA Gene: Mflv_1312: 50S ribosomal protein L28 |
|
*
Mycobacterium marinum M Site: position = -43 score = 5.80851 sequence = TGTCGAAAATGATTTTCAATA Site: position = -99 score = 6.43811 sequence = TATTGAAAACGATTTTCATTA Gene: MMAR_0292: 50S ribosomal protein L28 |
*
Mycobacterium smegmatis str. MC2 155 Site: position = -55 score = 6.3073 sequence = TATTGAAAACGATTGTCATTA Gene: MSMEG_6068: 50S ribosomal protein L28 |
*
Mycobacterium sp. JLS Site: position = -34 score = 5.74477 sequence = TGTCGAAAATGGTTTTCAATA Site: position = -89 score = 5.70036 sequence = TGTTGAGAACGATTGTCAATA Gene: Mjls_5116: 50S ribosomal protein L28 |
*2
Mycobacterium tuberculosis H37Rv Site: position = -103 score = 5.55538 sequence = TATCGATAACAGTTTTCATTA Site: position = -48 score = 5.80851 sequence = TGTCGAAAATGATTTTCAATA Gene: Rv2058c: 50S ribosomal protein L28 Site: position = -99 score = 6.16839 sequence = TATTGAAAATGATTGCCATTA Site: position = -45 score = 5.21184 sequence = TGTCGAAAACTATTTTCAACA Gene: Rv0105c: 50S ribosomal protein L28 |
*
Mycobacterium vanbaalenii PYR-1 Site: position = -33 score = 5.54213 sequence = TGTCGAAAACGATTTCCAATA Site: position = -88 score = 5.79585 sequence = TAATGGGAATGATTTCCAATA Gene: Mvan_5489: 50S ribosomal protein L28 |
50S ribosomal protein L28 |
| rpmG1 |
Gene: MAB_0333c: 50S ribosomal protein L33 |
Gene: MAV_4876: 50S ribosomal protein L33 |
Gene: Mflv_1311: 50S ribosomal protein L33 |
|
Gene: MMAR_0291: 50S ribosomal protein L33 |
Gene: MSMEG_6067: 50S ribosomal protein L33 |
Gene: Mjls_5115: 50S ribosomal protein L33 |
Gene: Rv2057c: 50S ribosomal protein L33 |
Gene: Mvan_5490: 50S ribosomal protein L33 |
50S ribosomal protein L33 |
| rpsN2 |
Gene: MAB_0332c: SSU ribosomal protein S14p |
|
Gene: Mflv_1310: SSU ribosomal protein S14p |
|
Gene: MMAR_0290: SSU ribosomal protein S14p |
Gene: MSMEG_6066: SSU ribosomal protein S14p |
|
Gene: Rv2056c: SSU ribosomal protein S14p |
Gene: Mvan_5491: SSU ribosomal protein S14p |
SSU ribosomal protein S14p |
| rpsR1 |
Gene: MAB_0331c: 30S ribosomal protein S18 |
|
Gene: Mflv_1309: 30S ribosomal protein S18 |
|
Gene: MMAR_0289: 30S ribosomal protein S18 |
Gene: MSMEG_6065: 30S ribosomal protein S18 |
|
Gene: Rv2055c: 30S ribosomal protein S18 |
Gene: Mvan_5492: 30S ribosomal protein S18 |
30S ribosomal protein S18 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |