Regulon of Zur in Mycobacterium sp. JLS

Properties
Regulator type:	Transcription factor
TF locus tag:	Mjls_3458
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Mycobacteriaceae
Statistics of regulated genes:
- Genes	14
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 70 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -89 Score: 5.7 Sequence: TGTTGAGAACGATTGTCAATA Position: -34 Score: 5.7 Sequence: TGTCGAAAATGGTTTTCAATA Locus tag: Mjls_5116 Name: rpmB1 Funciton: 50S ribosomal protein L28 Locus tag: Mjls_5115 Name: rpmG1 Funciton: 50S ribosomal protein L33
	Mjls_5116	rpmB1	50S ribosomal protein L28
	Mjls_5115	rpmG1	50S ribosomal protein L33
Position: -2 Score: 5.7 Sequence: TAATGAAAATCGTTTCCAGCA Locus tag: Mjls_3457 Name: znr Funciton: Zinc homeostasis transcriptional regulator Znr, ArsR family Locus tag: Mjls_3458 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	Mjls_3457	znr	Zinc homeostasis transcriptional regulator Znr, ArsR family
	Mjls_3458	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -90 Score: 6.2 Sequence: TGTTGAAAATGATTTTCATTA Locus tag: Mjls_5110 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Mjls_5109 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Mjls_5108 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Mjls_5107 Name: Mflv_3560 Funciton: putative secreted protein
	Mjls_5110	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	Mjls_5109	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	Mjls_5108	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Mjls_5107	Mflv_3560	putative secreted protein
Position: -88 Score: 5.7 Sequence: TATTGAAAACCATTTTCGACA Position: -33 Score: 5.7 Sequence: TATTGACAATCGTTCTCAACA Locus tag: Mjls_5117 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	Mjls_5117	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -88 Score: 5.5 Sequence: AAATGCAAACCGTTATCATTA Locus tag: Mjls_5104 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Mjls_5103 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Mjls_5102 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Mjls_5104	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Mjls_5103	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Mjls_5102	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -2 Score: 6.2 Sequence: TAATGAAAATCATTTTCAACA Locus tag: Mjls_5111 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Mjls_5112 Name: lamB Funciton: Conserved hypothetical protein (LamB/YcsF)
	Mjls_5111	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	Mjls_5112	lamB	Conserved hypothetical protein (LamB/YcsF)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Mycobacterium sp. JLS

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --