Regulon of Zur in Mycobacterium avium 104

Properties
Regulator type:	Transcription factor
TF locus tag:	MAV_2036
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Mycobacteriaceae
Statistics of regulated genes:
- Genes	11
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 70 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 4.7 Sequence: TGCTGATAACGATAATCATTT Position: -65 Score: 5.4 Sequence: TAACGATAATCATTTTCACTT Locus tag: MAV_4349 Name: ppe3 Funciton: PPE family protein, PPE3
	MAV_4349	ppe3	PPE family protein, PPE3
Position: -69 Score: 4.4 Sequence: GGTTGATAACGATAATCATTT Position: -63 Score: 5.9 Sequence: TAACGATAATCATTTTCATTA Locus tag: MAV_4879 Name: ppe3 Funciton: PPE family protein, PPE3
	MAV_4879	ppe3	PPE family protein, PPE3
Position: -232 Score: 6.2 Sequence: TAATGAAAATGATTTTCAGTA Locus tag: MAV_4871 Name: Rv0282 Funciton: Conserved hypothetical protein (AAA ATPase?) Locus tag: MAV_4870 Name: Rv0283 Funciton: hypothetical protein Rv0283
	MAV_4871	Rv0282	Conserved hypothetical protein (AAA ATPase?)
	MAV_4870	Rv0283	hypothetical protein Rv0283
Position: -93 Score: 5.5 Sequence: TATTGGTAATCGTTTTCATCT Position: -38 Score: 5.8 Sequence: TGTCGAAAATGATTTTCAATA Locus tag: MAV_4875 Name: rpmB1 Funciton: 50S ribosomal protein L28 Locus tag: MAV_4876 Name: rpmG1 Funciton: 50S ribosomal protein L33
	MAV_4875	rpmB1	50S ribosomal protein L28
	MAV_4876	rpmG1	50S ribosomal protein L33
Position: -136 Score: 5.8 Sequence: TATTGAAAATCATTTTCGACA Position: -81 Score: 5.5 Sequence: AGATGAAAACGATTACCAATA Locus tag: MAV_4874 Name: yciC3 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	MAV_4874	yciC3	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -63 Score: 6.3 Sequence: TAATGGAAACGATTTTCATTA Locus tag: MAV_0583 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: MAV_0582 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MAV_0581 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: MAV_0580 Name: lamB Funciton: Conserved hypothetical protein (LamB/YcsF)
	MAV_0583	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	MAV_0582	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	MAV_0581	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	MAV_0580	lamB	Conserved hypothetical protein (LamB/YcsF)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD