Regulon of Zur in Mycobacterium abscessus ATCC 19977

Properties
Regulator type:	Transcription factor
TF locus tag:	MAB_1678c
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Mycobacteriaceae
Statistics of regulated genes:
- Genes	11
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 70 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -25 Score: 6.1 Sequence: TAATGATAATGGTTATCATTA Position: -19 Score: 4.7 Sequence: TAATGGTTATCATTATCATGT Locus tag: MAB_1046c Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	MAB_1046c	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -43 Score: 6.5 Sequence: TAATGAAAATCGTTTTCATTA Locus tag: MAB_0577c Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: MAB_0576c Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MAB_0575c Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: MAB_0574c Name: lamB Funciton: Conserved hypothetical protein (LamB/YcsF)
	MAB_0577c	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	MAB_0576c	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	MAB_0575c	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	MAB_0574c	lamB	Conserved hypothetical protein (LamB/YcsF)
Position: -106 Score: 5.3 Sequence: TAATGGGAATCATTTTCGACA Position: -51 Score: 5.8 Sequence: TAATGAAAATCGTTTGCATTT Locus tag: MAB_0335 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: MAB_0336 Name: rpmE2 Funciton: 50S ribosomal protein L31
	MAB_0335	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	MAB_0336	rpmE2	50S ribosomal protein L31
Position: -90 Score: 5.8 Sequence: AAATGCAAACGATTTTCATTA Position: -35 Score: 5.3 Sequence: TGTCGAAAATGATTCCCATTA Locus tag: MAB_0334c Name: rpmB1 Funciton: 50S ribosomal protein L28 Locus tag: MAB_0333c Name: rpmG1 Funciton: 50S ribosomal protein L33 Locus tag: MAB_0332c Name: rpsN2 Funciton: SSU ribosomal protein S14p Locus tag: MAB_0331c Name: rpsR1 Funciton: 30S ribosomal protein S18
	MAB_0334c	rpmB1	50S ribosomal protein L28
	MAB_0333c	rpmG1	50S ribosomal protein L33
	MAB_0332c	rpsN2	SSU ribosomal protein S14p
	MAB_0331c	rpsR1	30S ribosomal protein S18

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD