Regulon of Zur in Mycobacterium flavescens PYR-GCK

Properties
Regulator type:	Transcription factor
TF locus tag:	Mflv_2717
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Mycobacteriaceae
Statistics of regulated genes:
- Genes	9
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 70 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -2 Score: 5.3 Sequence: TAATGAAAACGGTTATCGTAT Locus tag: Mflv_1454 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Mflv_1455 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Mflv_1456 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Mflv_1454	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Mflv_1455	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Mflv_1456	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -39 Score: 6.1 Sequence: TTTTGACAATGATTTTCATTA Locus tag: Mflv_3560 Name: Mflv_3560 Funciton: putative secreted protein
	Mflv_3560	Mflv_3560	putative secreted protein
Position: -99 Score: 5.3 Sequence: TAATGGGAATGATCTTCAATA Position: -44 Score: 5.8 Sequence: TGTCGAAAATGATTTTCAATA Locus tag: Mflv_1312 Name: rpmB1 Funciton: 50S ribosomal protein L28 Locus tag: Mflv_1311 Name: rpmG1 Funciton: 50S ribosomal protein L33 Locus tag: Mflv_1310 Name: rpsN2 Funciton: SSU ribosomal protein S14p Locus tag: Mflv_1309 Name: rpsR1 Funciton: 30S ribosomal protein S18
	Mflv_1312	rpmB1	50S ribosomal protein L28
	Mflv_1311	rpmG1	50S ribosomal protein L33
	Mflv_1310	rpsN2	SSU ribosomal protein S14p
	Mflv_1309	rpsR1	30S ribosomal protein S18
Position: -87 Score: 5.8 Sequence: TATTGAAAATCATTTTCGACA Position: -32 Score: 5.3 Sequence: TATTGAAGATCATTCCCATTA Locus tag: Mflv_1313 Name: yciC3 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	Mflv_1313	yciC3	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD