Regulon of Zur in Mycobacterium leprae TN

Properties
Regulator type:	Transcription factor
TF locus tag:	ML0824
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Mycobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 70 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -153 Score: 4.8 Sequence: ATATGATAATCGTATTCAGTA Locus tag: ML2537 Name: Rv0282 Funciton: Conserved hypothetical protein (AAA ATPase?) Locus tag: ML2536 Name: Rv0283 Funciton: hypothetical protein Rv0283 Locus tag: ML2535 Name: Rv0284 Funciton: conserved hypothetical protein Locus tag: ML2534 Name: Rv0285 Funciton: PE domain-containing protein
	ML2537	Rv0282	Conserved hypothetical protein (AAA ATPase?)
	ML2536	Rv0283	hypothetical protein Rv0283
	ML2535	Rv0284	conserved hypothetical protein
	ML2534	Rv0285	PE domain-containing protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD