Regulog PaaR - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Alphaproteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By taxonomy - Rhodobacterales
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Statistics of regulated genes
Genome	Genes	Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222	21	4
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654	6	2
Oceanicola granulosus HTCC2516
Oceanicola batsensis HTCC2597
Loktanella vestfoldensis SKA53
Roseovarius sp. 217
Roseovarius nubinhibens ISM
Sulfitobacter sp. EE-36
Silicibacter TM1040	6	2
Silicibacter pomeroyi DSS-3	7	3
Roseobacter sp. MED193	6	2
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
paaF	Rhodobacter sphaeroides 2.4.1	* Paracoccus denitrificans PD1222 Site: position = -74 score = 6.57811 sequence = ATTGACCGGCCGGTCGGTTTAT Gene: Pden_4799: Enoyl-CoA hydratase (EC 4.2.1.17)	Jannaschia sp. CCS1	* Rhodobacterales bacterium HTCC2654 Site: position = -54 score = 6.12994 sequence = ATTGACCGACCAGTCGGTTTAA Gene: RB2654_06379: Enoyl-CoA hydratase (EC 4.2.1.17)	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36	* Silicibacter TM1040 Site: position = -78 score = 6.71466 sequence = ATTGACCGTCCGGTCGGTTTAT Gene: TM1040_0438: Enoyl-CoA hydratase (EC 4.2.1.17)	* Silicibacter pomeroyi DSS-3 Site: position = -61 score = 6.4464 sequence = ATTGACCAACCGTTCGGTTTAT Gene: SPO0740: Enoyl-CoA hydratase (EC 4.2.1.17)	* Roseobacter sp. MED193 Site: position = -95 score = 6.71466 sequence = ATTGACCGTCCGGTCGGTTTAT Gene: MED193_17309: Enoyl-CoA hydratase (EC 4.2.1.17)	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Enoyl-CoA hydratase (EC 4.2.1.17)
paaY	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4800: thioesterase superfamily protein	Jannaschia sp. CCS1 Gene: Jann_0657: thioesterase superfamily protein	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06374: thioesterase superfamily protein	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36 Gene: EE36_06318: thioesterase superfamily protein	Silicibacter TM1040 Gene: TM1040_0439: thioesterase superfamily protein	Silicibacter pomeroyi DSS-3 Gene: SPO0741: thioesterase superfamily protein	Roseobacter sp. MED193 Gene: MED193_17314: thioesterase superfamily protein	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	thioesterase superfamily protein
paaK	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4801: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Jannaschia sp. CCS1 Gene: Jann_0656: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06369: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36 Gene: EE36_06323: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Silicibacter TM1040 Gene: TM1040_0440: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Silicibacter pomeroyi DSS-3 Gene: SPO0742: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Roseobacter sp. MED193 Gene: MED193_17319: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaR	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4802: Transcriptional regulator of phenylacetic acid degradation, TetR family	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06364: Transcriptional regulator of phenylacetic acid degradation, TetR family	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36	Silicibacter TM1040 Gene: TM1040_0441: Transcriptional regulator of phenylacetic acid degradation, TetR family	Silicibacter pomeroyi DSS-3 Gene: SPO0743: Transcriptional regulator of phenylacetic acid degradation, TetR family	Roseobacter sp. MED193 Gene: MED193_17324: Transcriptional regulator of phenylacetic acid degradation, TetR family	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Transcriptional regulator of phenylacetic acid degradation, TetR family

CRON 2.
paaJ	Rhodobacter sphaeroides 2.4.1	* Paracoccus denitrificans PD1222 Site: position = -61 score = 6.02649 sequence = ATTGACCAATCGGTCGGTGAAT Gene: Pden_4811: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06329: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36 Gene: EE36_06698: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)	Silicibacter TM1040	Silicibacter pomeroyi DSS-3 Gene: SPO0758: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)	Roseobacter sp. MED193 Gene: MED193_10303: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
paaA	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4810: Phenylacetate-CoA oxygenase, PaaA subunit	Jannaschia sp. CCS1 Gene: Jann_0655: Phenylacetate-CoA oxygenase, PaaA subunit	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06334: Phenylacetate-CoA oxygenase, PaaA subunit	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36 Gene: EE36_06703: Phenylacetate-CoA oxygenase, PaaA subunit	Silicibacter TM1040 Gene: TM1040_3724: Phenylacetate-CoA oxygenase, PaaA subunit	Silicibacter pomeroyi DSS-3 Gene: SPO0757: Phenylacetate-CoA oxygenase, PaaA subunit	Roseobacter sp. MED193 Gene: MED193_10308: Phenylacetate-CoA oxygenase, PaaA subunit	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Phenylacetate-CoA oxygenase, PaaA subunit
paaB	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4809: Phenylacetate-CoA oxygenase, PaaB subunit	Jannaschia sp. CCS1 Gene: Jann_0654: Phenylacetate-CoA oxygenase, PaaB subunit	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06339: Phenylacetate-CoA oxygenase, PaaB subunit	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36 Gene: EE36_06708: Phenylacetate-CoA oxygenase, PaaB subunit	Silicibacter TM1040 Gene: TM1040_3725: Phenylacetate-CoA oxygenase, PaaB subunit	Silicibacter pomeroyi DSS-3 Gene: SPO0756: Phenylacetate-CoA oxygenase, PaaB subunit	Roseobacter sp. MED193 Gene: MED193_10318: Phenylacetate-CoA oxygenase, PaaB subunit	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Phenylacetate-CoA oxygenase, PaaB subunit
paaC	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4808: Phenylacetate-CoA oxygenase, PaaC subunit	Jannaschia sp. CCS1 Gene: Jann_0653: Phenylacetate-CoA oxygenase, PaaC subunit	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06344: Phenylacetate-CoA oxygenase, PaaC subunit	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36 Gene: EE36_06713: Phenylacetate-CoA oxygenase, PaaC subunit	Silicibacter TM1040 Gene: TM1040_3726: Phenylacetate-CoA oxygenase, PaaC subunit	Silicibacter pomeroyi DSS-3 Gene: SPO0755: Phenylacetate-CoA oxygenase, PaaC subunit	Roseobacter sp. MED193 Gene: MED193_10323: Phenylacetate-CoA oxygenase, PaaC subunit	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Phenylacetate-CoA oxygenase, PaaC subunit
paaD	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4807: Phenylacetate-CoA oxygenase, PaaD subunit	Jannaschia sp. CCS1 Gene: Jann_0652: Phenylacetate-CoA oxygenase, PaaD subunit	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06349: Phenylacetate-CoA oxygenase, PaaD subunit	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36 Gene: EE36_06718: Phenylacetate-CoA oxygenase, PaaD subunit	Silicibacter TM1040 Gene: TM1040_3727: Phenylacetate-CoA oxygenase, PaaD subunit	Silicibacter pomeroyi DSS-3 Gene: SPO0754: Phenylacetate-CoA oxygenase, PaaD subunit	Roseobacter sp. MED193 Gene: MED193_10328: Phenylacetate-CoA oxygenase, PaaD subunit	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Phenylacetate-CoA oxygenase, PaaD subunit
paaE	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4806: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Jannaschia sp. CCS1 Gene: Jann_0651: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06354: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36 Gene: EE36_06723: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Silicibacter TM1040 Gene: TM1040_3728: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Silicibacter pomeroyi DSS-3 Gene: SPO0753: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Roseobacter sp. MED193 Gene: MED193_10333: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Pden_4805	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4805: Phenylacetic acid catabolic protein	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06359: Phenylacetic acid catabolic protein	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3 Gene: SPO0752: Phenylacetic acid catabolic protein	Roseobacter sp. MED193 Gene: MED193_10338: Phenylacetic acid catabolic protein	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Phenylacetic acid catabolic protein
paaZ	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4804: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	Jannaschia sp. CCS1 Gene: Jann_0658: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	* Rhodobacterales bacterium HTCC2654 Site: position = -66 score = 6.12994 sequence = TTAAACCGACTGGTCGGTCAAT Gene: RB2654_06384: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36 Gene: EE36_06728: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	* Silicibacter TM1040 Site: position = -104 score = 6.71466 sequence = ATAAACCGACCGGACGGTCAAT Gene: TM1040_0437: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	* Silicibacter pomeroyi DSS-3 Site: position = -90 score = 5.35525 sequence = ATTGACCGACCGTTCGGTCGCG Gene: SPO0735: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	* Roseobacter sp. MED193 Site: position = -114 score = 6.71466 sequence = ATAAACCGACCGGACGGTCAAT Gene: MED193_17304: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaX	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4812: Phenylacetic acid degradation operon negative regulatory protein paaX	Jannaschia sp. CCS1 Gene: Jann_0659: Phenylacetic acid degradation operon negative regulatory protein paaX	Rhodobacterales bacterium HTCC2654 Gene: RB2654_06389: Phenylacetic acid degradation operon negative regulatory protein paaX	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36 Gene: EE36_06733: Phenylacetic acid degradation operon negative regulatory protein paaX	Silicibacter TM1040 Gene: TM1040_0436: Phenylacetic acid degradation operon negative regulatory protein paaX	Silicibacter pomeroyi DSS-3 Gene: SPO0734: Phenylacetic acid degradation operon negative regulatory protein paaX	Roseobacter sp. MED193 Gene: MED193_17299: Phenylacetic acid degradation operon negative regulatory protein paaX	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Phenylacetic acid degradation operon negative regulatory protein paaX
Pden_4813	Rhodobacter sphaeroides 2.4.1	* Paracoccus denitrificans PD1222 Site: position = -74 score = 5.89843 sequence = ATTGACCGACCGAACGGTTAAC Gene: Pden_4813: Penicillin G acylase	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Penicillin G acylase

CRON 3.
paaZ2	Rhodobacter sphaeroides 2.4.1	* Paracoccus denitrificans PD1222 Site: position = -20 score = 6.57811 sequence = ATAAACCGACCGGCCGGTCAAT Gene: paaZ2: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
livK	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4797: Putative branched-chain amino acid ABC transporter, substrate-binding component	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Putative branched-chain amino acid ABC transporter, substrate-binding component
livH	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4796: Putative branched-chain amino acid ABC transporter, permease component	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Putative branched-chain amino acid ABC transporter, permease component
livF	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4795: Putative branched-chain amino acid ABC transporter, permease component 2	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Putative branched-chain amino acid ABC transporter, permease component 2
livM1	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4794: utative branched-chain amino acid ABC transporter, ATPase component 1	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	utative branched-chain amino acid ABC transporter, ATPase component 1
livM2	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_4793: utative branched-chain amino acid ABC transporter, ATPase component 2	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	utative branched-chain amino acid ABC transporter, ATPase component 2
fadB	Rhodobacter sphaeroides 2.4.1 Gene: RSP_3535: Enoyl-CoA hydratase (EC 4.2.1.17)	Paracoccus denitrificans PD1222 Gene: Pden_4792: Enoyl-CoA hydratase (EC 4.2.1.17)	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Enoyl-CoA hydratase (EC 4.2.1.17)

CRON 4.
paaG	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_0201: Enoyl-CoA hydratase (EC 4.2.1.17)	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Oceanicola batsensis HTCC2597 Gene: OB2597_18651: Enoyl-CoA hydratase (EC 4.2.1.17)	Loktanella vestfoldensis SKA53	Roseovarius sp. 217	Roseovarius nubinhibens ISM	Sulfitobacter sp. EE-36	Silicibacter TM1040	* Silicibacter pomeroyi DSS-3 Site: position = -63 score = 6.4464 sequence = ATAAACCGAACGGTTGGTCAAT Gene: SPO0739: Enoyl-CoA hydratase (EC 4.2.1.17)	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Enoyl-CoA hydratase (EC 4.2.1.17)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PaaR - Rhodobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --