Orthologous regulated operons containing paaC gene

Properties
Regulog:	PaaR - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Alphaproteobacteria

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Paracoccus denitrificans PD1222
Position: -61 Score: 6.02649 Sequence: ATTGACCAATCGGTCGGTGAAT Locus tag: Pden_4811 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: Pden_4810 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Pden_4809 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Pden_4808 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Pden_4807 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Pden_4806 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Pden_4805 Name: Pden_4805 Funciton: Phenylacetic acid catabolic protein Locus tag: Pden_4804 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaJ-paaA-paaB-paaC-paaD-paaE-Pden_4805-paaZ	-61	6	ATTGACCAATCGGTCGGTGAAT	Pden_4811

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --