Regulon of PaaR in Silicibacter TM1040

Properties
Regulator type:	Transcription factor
TF locus tag:	TM1040_0441
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Rhodobacterales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By taxonomy - Rhodobacterales
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 6.7 Sequence: ATAAACCGACCGGACGGTCAAT Locus tag: TM1040_0437 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: TM1040_0436 Name: paaX Funciton: Phenylacetic acid degradation operon negative regulatory protein paaX
	TM1040_0437	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	TM1040_0436	paaX	Phenylacetic acid degradation operon negative regulatory protein paaX
Position: -78 Score: 6.7 Sequence: ATTGACCGTCCGGTCGGTTTAT Locus tag: TM1040_0438 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: TM1040_0439 Name: paaY Funciton: thioesterase superfamily protein Locus tag: TM1040_0440 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: TM1040_0441 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	TM1040_0438	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	TM1040_0439	paaY	thioesterase superfamily protein
	TM1040_0440	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	TM1040_0441	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD