Orthologous regulated operons containing Pden_4813 gene

Properties
Regulog:	PaaR - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Alphaproteobacteria

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Paracoccus denitrificans PD1222
Position: -74 Score: 5.89843 Sequence: ATTGACCGACCGAACGGTTAAC Locus tag: Pden_4813 Name: null Funciton: Penicillin G acylase Locus tag: Pden_4812 Name: paaX Funciton: Phenylacetic acid degradation operon negative regulatory protein paaX
Pden_4813-paaX	-74	5.9	ATTGACCGACCGAACGGTTAAC	Pden_4813

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --