Orthologous regulated operons containing livH gene

Properties
Regulog:	PaaR - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Alphaproteobacteria

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Paracoccus denitrificans PD1222
Position: -20 Score: 6.57811 Sequence: ATAAACCGACCGGCCGGTCAAT Locus tag: paaZ2 Name: paaZ2 Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: Pden_4797 Name: livK Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component Locus tag: Pden_4796 Name: livH Funciton: Putative branched-chain amino acid ABC transporter, permease component Locus tag: Pden_4795 Name: livF Funciton: Putative branched-chain amino acid ABC transporter, permease component 2 Locus tag: Pden_4794 Name: livM1 Funciton: utative branched-chain amino acid ABC transporter, ATPase component 1 Locus tag: Pden_4793 Name: livM2 Funciton: utative branched-chain amino acid ABC transporter, ATPase component 2 Locus tag: Pden_4792 Name: fadB Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
paaZ2-livK-livH-livF-livM1-livM2-fadB	-20	6.6	ATAAACCGACCGGCCGGTCAAT	paaZ2

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --