Regulog PaaR - Ralstonia
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Phenylacetic acid degradation |
| Effector: | Phenylacetyl-CoA |
| Phylum: | Betaproteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Ralstonia
- By trascription factor - PaaR
- By TF family - TetR
- By effector - Phenylacetyl-CoA
- By pathway - Phenylacetic acid degradation
| Genome | Genes | Operons |
|---|---|---|
| Cupriavidus taiwanensis | 11 | 3 |
| Ralstonia eutropha H16 | 11 | 3 |
| Ralstonia eutropha JMP134 | 11 | 3 |
| Ralstonia metallidurans CH34 | 11 | 3 |
| Ralstonia pickettii 12J | 9 | 3 |
| Ralstonia solanacearum GMI1000 | 9 | 3 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| paaA |
*
Cupriavidus taiwanensis Site: position = -83 score = 6.22724 sequence = ATTGACCGACCGGTCGGCTTAT Gene: RALTA_A2973: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Ralstonia eutropha H16 Site: position = -79 score = 5.73852 sequence = ATTGACCGACCGGTCGGCATAT Gene: H16_A3520: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Ralstonia eutropha JMP134 Site: position = -95 score = 6.22724 sequence = ATTGACCGACCGGTCGGCTTAT Gene: Reut_A3206: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Ralstonia metallidurans CH34 Site: position = -113 score = 6.76152 sequence = ATTGACCGACCGGTCGGTTTAT Gene: Rmet_3369: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Ralstonia pickettii 12J Site: position = -96 score = 6.34603 sequence = ATTGACCGACCGGTCGGACGGT Gene: Rpic_4567: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Ralstonia solanacearum GMI1000 Site: position = -97 score = 6.30204 sequence = ATTGACCGACCGGTCGGACGAT Gene: RSp0604: Phenylacetate-CoA oxygenase, PaaA subunit |
Phenylacetate-CoA oxygenase, PaaA subunit |
| paaB |
Gene: RALTA_A2974: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: H16_A3521: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Reut_A3207: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Rmet_3370: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Rpic_4566: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: RSp0605: Phenylacetate-CoA oxygenase, PaaB subunit |
Phenylacetate-CoA oxygenase, PaaB subunit |
| paaC |
Gene: RALTA_A2975: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: H16_A3522: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Reut_A3208: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Rmet_3371: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Rpic_4565: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: RSp0606: Phenylacetate-CoA oxygenase, PaaC subunit |
Phenylacetate-CoA oxygenase, PaaC subunit |
| paaD |
Gene: RALTA_A2976: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: H16_A3523: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Reut_A3209: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Rmet_3372: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Rpic_4564: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: RSp0607: Phenylacetate-CoA oxygenase, PaaD subunit |
Phenylacetate-CoA oxygenase, PaaD subunit |
| paaE |
Gene: RALTA_A2977: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: H16_A3524: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Reut_A3210: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Rmet_3373: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Rpic_4563: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: RSp0608: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
| paaW |
Gene: RALTA_A2978: Protein of unknown function DUF3658/DUF1835 |
Gene: H16_A3525: Protein of unknown function DUF3658/DUF1835 |
Gene: Reut_A3211: Protein of unknown function DUF3658/DUF1835 |
Gene: Rmet_3374: Protein of unknown function DUF3658/DUF1835 |
Gene: Rpic_3378: Protein of unknown function DUF3658/DUF1835 |
Gene: RS00547: Protein of unknown function DUF3658/DUF1835 |
Protein of unknown function DUF3658/DUF1835 |
| paaR |
Gene: RALTA_A2979: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: H16_A3526: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: Reut_A3212: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: Rmet_3375: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: Rpic_4562: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: RS03754: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Transcriptional regulator of phenylacetic acid degradation, TetR family |
| CRON 2. | |||||||
| paaF2 |
Gene: RALTA_A2759: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: H16_A3307: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Reut_A3010: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Ralstonia metallidurans CH34 Site: position = -149 score = 6.06377 sequence = ATTAACCGACCAGTCGGTCGGC Gene: Rmet_3162: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Ralstonia pickettii 12J Site: position = -53 score = 6.45764 sequence = ATTAACCGACCGGTTGGTCGGC Gene: Rpic_3114: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Ralstonia solanacearum GMI1000 Site: position = -53 score = 6.45764 sequence = ATTAACCGACCGGTTGGTCGGC Gene: RSc2872: Enoyl-CoA hydratase (EC 4.2.1.17) |
Enoyl-CoA hydratase (EC 4.2.1.17) |
| CRON 3. | |||||||
| paaG |
*
Cupriavidus taiwanensis Site: position = -31 score = 6.57466 sequence = ATTAACCGACCGATCGGTTGGT Gene: RALTA_A0085: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Ralstonia eutropha H16 Site: position = -72 score = 6.20418 sequence = ATTAACCGACCGATCGGTTGGC Gene: H16_A0142: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Ralstonia eutropha JMP134 Site: position = -73 score = 6.37111 sequence = ATTTACCGACCGGCCGGTTGGT Gene: Reut_A0110: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Rmet_0080: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Rpic_0159: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: RS03271: Enoyl-CoA hydratase (EC 4.2.1.17) |
Enoyl-CoA hydratase (EC 4.2.1.17) |
| CRON 4. | |||||||
| paaF |
*
Cupriavidus taiwanensis Site: position = -89 score = 5.69244 sequence = GCCGACCGACTGGTCGGTTTAT Gene: RALTA_A2763: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Ralstonia eutropha H16 Site: position = -90 score = 5.69244 sequence = GCCGACCGACTGGTCGGTTTAT Gene: H16_A3311: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Ralstonia eutropha JMP134 Site: position = -61 score = 6.1825 sequence = ACCGACCGATCGGTCGGTTAAT Gene: Reut_A3015: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Ralstonia metallidurans CH34 Site: position = -100 score = 5.81944 sequence = GCCGACCGACTGGTCGGTTAAT Gene: Rmet_3163: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Ralstonia pickettii 12J Site: position = -52 score = 6.23932 sequence = GCCGACCAACCGGTCGGTTAAT Gene: Rpic_3115: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Ralstonia solanacearum GMI1000 Site: position = -48 score = 6.23932 sequence = GCCGACCAACCGGTCGGTTAAT Gene: RSc2873: Enoyl-CoA hydratase (EC 4.2.1.17) |
Enoyl-CoA hydratase (EC 4.2.1.17) |
| paaY |
Gene: RALTA_A2764: thioesterase superfamily protein |
Gene: H16_A3312: thioesterase superfamily protein |
Gene: Reut_A3016: thioesterase superfamily protein |
Gene: Rmet_3164: thioesterase superfamily protein |
Gene: Rpic_3116: thioesterase superfamily protein |
Gene: RSc2874: thioesterase superfamily protein |
thioesterase superfamily protein |
| paaK |
Gene: RALTA_A2765: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: H16_A3313: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: Reut_A3017: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: Rmet_3165: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: Rpic_3117: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: RSc2875: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |