Regulon of PaaR in Cupriavidus taiwanensis

Properties
Regulator type:	Transcription factor
TF locus tag:	RALTA_A2979
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Ralstonia
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 6.6 Sequence: ATTAACCGACCGATCGGTTGGT Locus tag: RALTA_A0085 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	RALTA_A0085	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -89 Score: 5.7 Sequence: GCCGACCGACTGGTCGGTTTAT Locus tag: RALTA_A2763 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: RALTA_A2764 Name: paaY Funciton: thioesterase superfamily protein Locus tag: RALTA_A2765 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	RALTA_A2763	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	RALTA_A2764	paaY	thioesterase superfamily protein
	RALTA_A2765	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -83 Score: 6.2 Sequence: ATTGACCGACCGGTCGGCTTAT Locus tag: RALTA_A2973 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: RALTA_A2974 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: RALTA_A2975 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: RALTA_A2976 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: RALTA_A2977 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: RALTA_A2978 Name: paaW Funciton: Protein of unknown function DUF3658/DUF1835 Locus tag: RALTA_A2979 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	RALTA_A2973	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	RALTA_A2974	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	RALTA_A2975	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	RALTA_A2976	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	RALTA_A2977	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	RALTA_A2978	paaW	Protein of unknown function DUF3658/DUF1835
	RALTA_A2979	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD