Regulon of PaaR in Ralstonia solanacearum GMI1000

Properties
Regulator type:	Transcription factor
TF locus tag:	RS03754
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Ralstonia
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -48 Score: 6.2 Sequence: GCCGACCAACCGGTCGGTTAAT Locus tag: RSc2873 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: RSc2874 Name: paaY Funciton: thioesterase superfamily protein Locus tag: RSc2875 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	RSc2873	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	RSc2874	paaY	thioesterase superfamily protein
	RSc2875	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -97 Score: 6.3 Sequence: ATTGACCGACCGGTCGGACGAT Locus tag: RSp0604 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: RSp0605 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: RSp0606 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: RSp0607 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: RSp0608 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	RSp0604	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	RSp0605	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	RSp0606	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	RSp0607	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	RSp0608	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Position: -53 Score: 6.5 Sequence: ATTAACCGACCGGTTGGTCGGC Locus tag: RSc2872 Name: paaF2 Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	RSc2872	paaF2	Enoyl-CoA hydratase (EC 4.2.1.17)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD