Regulon of PaaR in Ralstonia pickettii 12J

Properties
Regulator type:	Transcription factor
TF locus tag:	Rpic_4562
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Ralstonia
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 6.2 Sequence: GCCGACCAACCGGTCGGTTAAT Locus tag: Rpic_3115 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Rpic_3116 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Rpic_3117 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Rpic_3115	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Rpic_3116	paaY	thioesterase superfamily protein
	Rpic_3117	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -96 Score: 6.3 Sequence: ATTGACCGACCGGTCGGACGGT Locus tag: Rpic_4567 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Rpic_4566 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Rpic_4565 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Rpic_4564 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Rpic_4563 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Rpic_4567	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Rpic_4566	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Rpic_4565	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Rpic_4564	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Rpic_4563	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Position: -53 Score: 6.5 Sequence: ATTAACCGACCGGTTGGTCGGC Locus tag: Rpic_3114 Name: paaF2 Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	Rpic_3114	paaF2	Enoyl-CoA hydratase (EC 4.2.1.17)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD