Regulon of PaaR in Ralstonia eutropha JMP134

Properties
Regulator type:	Transcription factor
TF locus tag:	Reut_A3212
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Ralstonia
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 6.4 Sequence: ATTTACCGACCGGCCGGTTGGT Locus tag: Reut_A0110 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	Reut_A0110	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -61 Score: 6.2 Sequence: ACCGACCGATCGGTCGGTTAAT Locus tag: Reut_A3015 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Reut_A3016 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Reut_A3017 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Reut_A3015	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Reut_A3016	paaY	thioesterase superfamily protein
	Reut_A3017	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -95 Score: 6.2 Sequence: ATTGACCGACCGGTCGGCTTAT Locus tag: Reut_A3206 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Reut_A3207 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Reut_A3208 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Reut_A3209 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Reut_A3210 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Reut_A3211 Name: paaW Funciton: Protein of unknown function DUF3658/DUF1835 Locus tag: Reut_A3212 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	Reut_A3206	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Reut_A3207	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Reut_A3208	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Reut_A3209	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Reut_A3210	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Reut_A3211	paaW	Protein of unknown function DUF3658/DUF1835
	Reut_A3212	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD