Regulog MntR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | 2 | 2 |
| Lactobacillus casei ATCC 334 | 4 | 2 |
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | 1 | 1 |
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | 4 | 2 |
| Lactobacillus reuteri JCM 1112 | 1 | 1 |
| Lactobacillus rhamnosus GG | 4 | 2 |
| Lactobacillus sakei subsp. sakei 23K | 5 | 3 |
| Lactobacillus salivarius subsp. salivarius UCC118 | 1 | 1 |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| mntH |
|
*2
Lactobacillus brevis ATCC 367 Site: position = -19 score = 4.9567 sequence = AAGGAAGGGAGTCTTAAAAT Gene: LVIS_0225: Manganese transport protein MntH Site: position = -213 score = 4.34354 sequence = ATTTTTGGTAAGCCAAAAAT Gene: LVIS_0331: Manganese transport protein MntH |
*
Lactobacillus casei ATCC 334 Site: position = -71 score = 6.35621 sequence = AAGTTAGGGAGACCTAAAAG Gene: LSEI_2413: Manganese transport protein MntH |
|
*
Lactobacillus fermentum IFO 3956 Site: position = -91 score = 4.82986 sequence = TTTTTATGCTAACCTAACAA Gene: LAF_1828: Manganese transport protein MntH |
|
Gene: LJ1144: Manganese transport protein MntH |
*
Lactobacillus plantarum WCFS1 Site: position = -98 score = 5.29665 sequence = TTTGTAGGCATACCTAAAAA Gene: lp_2992: Manganese transport protein MntH |
*
Lactobacillus reuteri JCM 1112 Site: position = -89 score = 4.82387 sequence = TTTTTATGTTACCCTAACAA Gene: LAR_1743: Manganese transport protein MntH |
*
Lactobacillus rhamnosus GG Site: position = -72 score = 6.35621 sequence = AAGTTAGGGAGACCTAAAAG Gene: LGG_02411: Manganese transport protein MntH |
*2
Lactobacillus sakei subsp. sakei 23K Site: position = 7 score = 5.53341 sequence = AAGTTAAGGGACCCAAAAAG Gene: LSA0246: Manganese transport protein MntH Site: position = -77 score = 5.83553 sequence = AAGTTAGGGCATCCTAAAAT Gene: LSA1699: Manganese transport protein MntH |
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -87 score = 5.21946 sequence = AGTTAAGGTAGACCTAAAAA Gene: LSL_0904: Manganese transport protein MntH |
|
2
Oenococcus oeni PSU-1 Gene: OEOE_1795: Manganese transport protein MntH Gene: OEOE_0246: Manganese transport protein MntH |
2
Pediococcus pentosaceus ATCC 25745 Gene: PEPE_0045: Manganese transport protein MntH Gene: PEPE_1701: Manganese transport protein MntH |
Manganese transport protein MntH |
| CRON 2. | ||||||||||||||||
| mntC |
|
|
*
Lactobacillus casei ATCC 334 Site: position = -32 score = 5.74106 sequence = GAATTAGGTCACCCTAAAAA Gene: LSEI_2423: Manganese ABC transporter, permease protein |
|
|
|
|
*
Lactobacillus plantarum WCFS1 Site: position = -82 score = 5.19094 sequence = AAGTTAACTGCACCTAACAA Gene: lp_1095: Manganese ABC transporter, permease protein |
|
*
Lactobacillus rhamnosus GG Site: position = -31 score = 5.62302 sequence = GAATTAGGTCACCCTAAAAT Gene: LGG_02421: Manganese ABC transporter, permease protein |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -34 score = 6.28858 sequence = AAGTTAGGTATACCTAAAAG Gene: LSA0180: Manganese ABC transporter, permease protein |
|
Gene: LEUM_0951: Manganese ABC transporter, permease protein |
|
|
Manganese ABC transporter, permease protein |
| mntB |
|
|
Gene: LSEI_2422: Manganese ABC transporter, ATP-binding protein |
|
|
|
|
Gene: lp_1096: Manganese ABC transporter, ATP-binding protein |
|
Gene: LGG_02420: Manganese ABC transporter, ATP-binding protein |
Gene: LSA0181: Manganese ABC transporter, ATP-binding protein |
|
Gene: LEUM_0952: Manganese ABC transporter, ATP-binding protein |
|
|
Manganese ABC transporter, ATP-binding protein |
| mntA |
|
|
Gene: LSEI_2421: Manganese ABC transporter, substrate-binding protein |
|
|
|
|
Gene: lp_1097: Manganese ABC transporter, substrate-binding protein |
|
Gene: LGG_02419: Manganese ABC transporter, substrate-binding protein |
Gene: LSA0182: Manganese ABC transporter, substrate-binding protein |
|
Gene: LEUM_0953: Manganese ABC transporter, substrate-binding protein |
|
|
Manganese ABC transporter, substrate-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |