Regulon of MntR in Lactobacillus rhamnosus GG

Properties
Regulator type:	Transcription factor
TF locus tag:	LGG_00759
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 5.6 Sequence: GAATTAGGTCACCCTAAAAT Locus tag: LGG_02421 Name: mntC Funciton: Manganese ABC transporter, permease protein Locus tag: LGG_02420 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: LGG_02419 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
	LGG_02421	mntC	Manganese ABC transporter, permease protein
	LGG_02420	mntB	Manganese ABC transporter, ATP-binding protein
	LGG_02419	mntA	Manganese ABC transporter, substrate-binding protein
Position: -72 Score: 6.4 Sequence: AAGTTAGGGAGACCTAAAAG Locus tag: LGG_02411 Name: mntH Funciton: Manganese transport protein MntH
	LGG_02411	mntH	Manganese transport protein MntH

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD