Regulon of MntR in Lactobacillus brevis ATCC 367

Properties
Regulator type:	Transcription factor
TF locus tag:	LVIS_1718
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -19 Score: 5 Sequence: AAGGAAGGGAGTCTTAAAAT Locus tag: LVIS_0225 Name: mntH Funciton: Manganese transport protein MntH
	LVIS_0225	mntH	Manganese transport protein MntH
Position: -213 Score: 4.3 Sequence: ATTTTTGGTAAGCCAAAAAT Locus tag: LVIS_0331 Name: mntH Funciton: Manganese transport protein MntH
	LVIS_0331	mntH	Manganese transport protein MntH

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD