Regulon of MntR in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type:	Transcription factor
TF locus tag:	LSA0380
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 6.3 Sequence: AAGTTAGGTATACCTAAAAG Locus tag: LSA0180 Name: mntC Funciton: Manganese ABC transporter, permease protein Locus tag: LSA0181 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: LSA0182 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
	LSA0180	mntC	Manganese ABC transporter, permease protein
	LSA0181	mntB	Manganese ABC transporter, ATP-binding protein
	LSA0182	mntA	Manganese ABC transporter, substrate-binding protein
Position: -77 Score: 5.8 Sequence: AAGTTAGGGCATCCTAAAAT Locus tag: LSA1699 Name: mntH Funciton: Manganese transport protein MntH
	LSA1699	mntH	Manganese transport protein MntH
Position: 7 Score: 5.5 Sequence: AAGTTAAGGGACCCAAAAAG Locus tag: LSA0246 Name: mntH Funciton: Manganese transport protein MntH
	LSA0246	mntH	Manganese transport protein MntH

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD