Regulon of MntR in Lactobacillus casei ATCC 334

Properties
Regulator type:	Transcription factor
TF locus tag:	LSEI_0777
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 5.7 Sequence: GAATTAGGTCACCCTAAAAA Locus tag: LSEI_2423 Name: mntC Funciton: Manganese ABC transporter, permease protein Locus tag: LSEI_2422 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: LSEI_2421 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
	LSEI_2423	mntC	Manganese ABC transporter, permease protein
	LSEI_2422	mntB	Manganese ABC transporter, ATP-binding protein
	LSEI_2421	mntA	Manganese ABC transporter, substrate-binding protein
Position: -71 Score: 6.4 Sequence: AAGTTAGGGAGACCTAAAAG Locus tag: LSEI_2413 Name: mntH Funciton: Manganese transport protein MntH
	LSEI_2413	mntH	Manganese transport protein MntH

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD