Orthologous regulated operons containing mntC gene

Properties
Regulog:	MntR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Firmicutes

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactobacillus casei ATCC 334
Position: -32 Score: 5.74106 Sequence: GAATTAGGTCACCCTAAAAA Locus tag: LSEI_2423 Name: mntC Funciton: Manganese ABC transporter, permease protein Locus tag: LSEI_2422 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: LSEI_2421 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
mntC-mntB-mntA	-32	5.7	GAATTAGGTCACCCTAAAAA	LSEI_2423
Lactobacillus plantarum WCFS1
Position: -82 Score: 5.19094 Sequence: AAGTTAACTGCACCTAACAA Locus tag: lp_1095 Name: mntC Funciton: Manganese ABC transporter, permease protein Locus tag: lp_1096 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: lp_1097 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
mntC-mntB-mntA	-82	5.2	AAGTTAACTGCACCTAACAA	lp_1095
Lactobacillus rhamnosus GG
Position: -31 Score: 5.62302 Sequence: GAATTAGGTCACCCTAAAAT Locus tag: LGG_02421 Name: mntC Funciton: Manganese ABC transporter, permease protein Locus tag: LGG_02420 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: LGG_02419 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
mntC-mntB-mntA	-31	5.6	GAATTAGGTCACCCTAAAAT	LGG_02421
Lactobacillus sakei subsp. sakei 23K
Position: -34 Score: 6.28858 Sequence: AAGTTAGGTATACCTAAAAG Locus tag: LSA0180 Name: mntC Funciton: Manganese ABC transporter, permease protein Locus tag: LSA0181 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: LSA0182 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
mntC-mntB-mntA	-34	6.3	AAGTTAGGTATACCTAAAAG	LSA0180