Regulog AmtR - Corynebacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Nitrogen metabolism |
| Effector: | GlnK-AMP, signal transduction protein |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - AmtR
- By taxonomy - Corynebacteriaceae
- By TF family - TetR
- By effector - GlnK-AMP, signal transduction protein
- By pathway - Nitrogen metabolism
| Genome | Genes | Operons |
|---|---|---|
| Corynebacterium amycolatum SK46 | ||
| Corynebacterium aurimucosum ATCC 700975 | 1 | 1 |
| Corynebacterium diphtheriae NCTC 13129 | 6 | 3 |
| Corynebacterium efficiens YS-314 | 29 | 12 |
| Corynebacterium glutamicum ATCC 13032 | 35 | 14 |
| Corynebacterium jeikeium K411 | ||
| Corynebacterium kroppenstedtii DSM 44385 | ||
| Corynebacterium urealyticum DSM 7109 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| amtB |
Gene: CORAM0001_0757: Ammonium transporter |
Gene: cauri_1592: Ammonium transporter |
|
*
Corynebacterium efficiens YS-314 Site: position = -168 score = 5.32366 sequence = GAATTCTATCGACCTATCGAAAGT Gene: CE1968: Ammonium transporter |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -140 score = 5.03768 sequence = CTATTCTATAGATCTATTGAAATT Site: position = -183 score = 5.43365 sequence = ATTACCTGTTAAACTATAGAAAAT Gene: cg2261: Ammonium transporter |
Gene: jk1197: Ammonium transporter |
Gene: ckrop_1189: Ammonium transporter |
Gene: cur_0795: Ammonium transporter |
Ammonium transporter |
| glnK |
|
Gene: cauri_1591: Nitrogen regulatory protein PII |
Gene: DIP1535: Nitrogen regulatory protein PII |
Gene: CE1967: Nitrogen regulatory protein PII |
Gene: cg2260: Nitrogen regulatory protein PII |
Gene: jk1196: Nitrogen regulatory protein PII |
Gene: ckrop_1188: Nitrogen regulatory protein PII |
|
Nitrogen regulatory protein PII |
| glnD |
|
Gene: cauri_1590: [Protein-PII] Uridylyltransferase |
Gene: DIP1534: [Protein-PII] Uridylyltransferase |
Gene: CE1966: [Protein-PII] Uridylyltransferase |
Gene: cg2258: [Protein-PII] Uridylyltransferase |
|
Gene: ckrop_1187: [Protein-PII] Uridylyltransferase |
|
[Protein-PII] Uridylyltransferase |
| CRON 2. | |||||||||
| cg1296 |
|
|
|
Gene: CE2924: Predicted non-ribosomal peptide synthetase |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -41 score = 5.99485 sequence = ATTTTCTATCAATCTATAGATACT Gene: cg1296: Predicted non-ribosomal peptide synthetase |
|
2
Corynebacterium kroppenstedtii DSM 44385 Gene: ckrop_0207: Predicted non-ribosomal peptide synthetase Gene: ckrop_0205: Predicted non-ribosomal peptide synthetase |
|
Predicted non-ribosomal peptide synthetase |
| CRON 3. | |||||||||
| cg1295 |
|
|
|
|
*
Corynebacterium glutamicum ATCC 13032 Site: position = -40 score = 6.17596 sequence = AGTATCTATAGATTGATAGAAAAT Gene: cg1295: Predicted hydrolase/acyltransferase |
|
|
|
Predicted hydrolase/acyltransferase |
| CRON 4. | |||||||||
| urtA |
|
|
|
*
Corynebacterium efficiens YS-314 Site: position = -39 score = 5.11903 sequence = TAAACCTGTCGATCTATAGAAATC Site: position = -65 score = 5.55439 sequence = ATTACCTATAGCTTTATAGAAACA Gene: CE1000: Urea ABC transporter, substrate-binding protein |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -68 score = 5.06896 sequence = ACTACCTATAGGCTGACAGAAACT Site: position = -42 score = 5.50602 sequence = AAAAACTATAGAGCTATAGAAACT Gene: cg1061: Urea ABC transporter, substrate-binding protein |
|
|
|
Urea ABC transporter, substrate-binding protein |
| urtB |
|
|
|
Gene: CE1001: Urea ABC transporter, permease protein 1 |
Gene: cg1062: Urea ABC transporter, permease protein 1 |
|
|
|
Urea ABC transporter, permease protein 1 |
| urtC |
|
|
|
Gene: CE1003: Urea ABC transporter, permease protein 2 |
Gene: cg1064: Urea ABC transporter, permease protein 2 |
|
|
|
Urea ABC transporter, permease protein 2 |
| urtD |
|
|
|
Gene: CE1004: Urea ABC transporter, ATP-binding protein 1 |
Gene: cg1065: Urea ABC transporter, ATP-binding protein 1 |
|
|
|
Urea ABC transporter, ATP-binding protein 1 |
| urtE |
|
|
|
Gene: CE1005: Urea ABC transporter, ATP-binding protein 2 |
Gene: cg1066: Urea ABC transporter, ATP-binding protein 2 |
|
|
|
Urea ABC transporter, ATP-binding protein 2 |
| CRON 5. | |||||||||
| gltB |
Gene: CORAM0001_1821: Glutamate synthase [NADPH] large chain (EC 1.4.1.13) |
|
|
*
Corynebacterium efficiens YS-314 Site: position = -107 score = 5.44048 sequence = TTTTCCTATAGGTTGATCGAAAAT Site: position = -40 score = 5.11972 sequence = ATTATCGAATGATTAATAGAAACC Gene: CE0158: Glutamate synthase [NADPH] large chain (EC 1.4.1.13) |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -46 score = 5.45972 sequence = ATTATCGAACGATTGATAGAAACA Site: position = -115 score = 5.26205 sequence = TTTTCCTATAGGTTGATCGAAAGT Gene: cg0229: Glutamate synthase [NADPH] large chain (EC 1.4.1.13) |
Gene: jk0076: Glutamate synthase [NADPH] large chain (EC 1.4.1.13) |
Gene: ckrop_0050: Glutamate synthase [NADPH] large chain (EC 1.4.1.13) |
|
Glutamate synthase [NADPH] large chain (EC 1.4.1.13) |
| gltD |
Gene: CORAM0001_1820: Glutamate synthase [NADPH] small chain (EC 1.4.1.13) |
|
|
Gene: CE0159: Glutamate synthase [NADPH] small chain (EC 1.4.1.13) |
Gene: cg0230: Glutamate synthase [NADPH] small chain (EC 1.4.1.13) |
Gene: jk0077: Glutamate synthase [NADPH] small chain (EC 1.4.1.13) |
Gene: ckrop_0051: Glutamate synthase [NADPH] small chain (EC 1.4.1.13) |
|
Glutamate synthase [NADPH] small chain (EC 1.4.1.13) |
| CRON 6. | |||||||||
| hkm |
|
|
|
*
Corynebacterium efficiens YS-314 Site: position = -46 score = 5.68381 sequence = ATTTTCGATCAACCTATAGGAAAA Site: position = -113 score = 5.08678 sequence = GGTTTCTATTAATCATTCGATAAT Gene: CE0157: Predicted sensor histidine kinase of two-component system |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -179 score = 5.39009 sequence = TGTTTCTATCAATCGTTCGATAAT Site: position = -110 score = 5.52819 sequence = ACTTTCGATCAACCTATAGGAAAA Gene: cg0228: Predicted sensor histidine kinase of two-component system |
|
|
|
Predicted sensor histidine kinase of two-component system |
| CRON 7. | |||||||||
| gluA |
Gene: CORAM0001_1423: Glutamate ABC transporter, ATP-binding protein |
Gene: cauri_1495: Glutamate ABC transporter, ATP-binding protein |
|
*
Corynebacterium efficiens YS-314 Site: position = -110 score = 4.90032 sequence = TTTACCTATTGAGCTATTGATAAA Gene: CE1844: Glutamate ABC transporter, ATP-binding protein |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -193 score = 5.23548 sequence = AATATCTATCATGTGATAGGTAAA Gene: cg2136: Glutamate ABC transporter, ATP-binding protein |
Gene: jk0654: Glutamate ABC transporter, ATP-binding protein |
Gene: ckrop_1106: Glutamate ABC transporter, ATP-binding protein |
|
Glutamate ABC transporter, ATP-binding protein |
| gluB |
Gene: CORAM0001_1424: Glutamate ABC transporter, substrate-binding protein |
Gene: cauri_1496: Glutamate ABC transporter, substrate-binding protein |
|
2
Corynebacterium efficiens YS-314 Gene: CE1845: Glutamate ABC transporter, substrate-binding protein Gene: CE1579: Glutamate ABC transporter, substrate-binding protein |
Gene: cg2137: Glutamate ABC transporter, substrate-binding protein |
Gene: jk0655: Glutamate ABC transporter, substrate-binding protein |
Gene: ckrop_1107: Glutamate ABC transporter, substrate-binding protein |
|
Glutamate ABC transporter, substrate-binding protein |
| gluC |
Gene: CORAM0001_1425: Glutamate ABC transporter, permease protein 1 |
Gene: cauri_1497: Glutamate ABC transporter, permease protein 1 |
|
Gene: CE1846: Glutamate ABC transporter, permease protein 1 |
Gene: cg2138: Glutamate ABC transporter, permease protein 1 |
Gene: jk0656: Glutamate ABC transporter, permease protein 1 |
|
|
Glutamate ABC transporter, permease protein 1 |
| gluD |
Gene: CORAM0001_1426: Glutamate ABC transporter, permease protein 2 |
Gene: cauri_1498: Glutamate ABC transporter, permease protein 2 |
|
Gene: CE1847: Glutamate ABC transporter, permease protein 2 |
Gene: cg2139: Glutamate ABC transporter, permease protein 2 |
Gene: jk0657: Glutamate ABC transporter, permease protein 2 |
Gene: ckrop_1110: Glutamate ABC transporter, permease protein 2 |
|
Glutamate ABC transporter, permease protein 2 |
| CRON 8. | |||||||||
| codA |
|
|
|
Gene: CE2849: Cytosine deaminase (EC 3.5.4.1) |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -60 score = 4.89894 sequence = AATACCTGTCAAGCAATAGAATAG Gene: cg0104: Cytosine deaminase (EC 3.5.4.1) |
|
|
|
Cytosine deaminase (EC 3.5.4.1) |
| CRON 9. | |||||||||
| crnT |
|
|
|
*
Corynebacterium efficiens YS-314 Site: position = -72 score = 5.34262 sequence = TAATTCTATAGATCAATAGAATTA Site: position = -27 score = 5.66994 sequence = AGTTTCTATCACTCAATAGAAAAG Gene: CE2850: Creatinine transporter |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -79 score = 5.71214 sequence = CATTTCTATCAATCTATAGAAAGT Site: position = -33 score = 5.9848 sequence = AGTTTCTATAGATTGATAGAAAAG Gene: cg0103: Creatinine transporter |
|
|
|
Creatinine transporter |
| CRON 10. | |||||||||
| gdh |
Gene: CORAM0001_1037: NADP-specific glutamate dehydrogenase (EC 1.4.1.4) |
*
Corynebacterium aurimucosum ATCC 700975 Site: position = -86 score = 5.14729 sequence = AATTTAGGTCGATTGATAGAAAAC Gene: cauri_1607: NADP-specific glutamate dehydrogenase (EC 1.4.1.4) |
*
Corynebacterium diphtheriae NCTC 13129 Site: position = -156 score = 5.33975 sequence = ACTTTCGATAGTTCAATAGGAATT Gene: DIP1547: NADP-specific glutamate dehydrogenase (EC 1.4.1.4) |
*
Corynebacterium efficiens YS-314 Site: position = -47 score = 4.56043 sequence = TAAAACTATTAACCGTTAGGTATA Gene: CE1982: NADP-specific glutamate dehydrogenase (EC 1.4.1.4) |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -209 score = 4.02969 sequence = TAAAACTATTAACCGTTAGTATGA Site: position = -367 score = 4.89355 sequence = AAAATTGATAAACCTAAAGAAATT Gene: cg2280: NADP-specific glutamate dehydrogenase (EC 1.4.1.4) |
|
Gene: ckrop_0600: NADP-specific glutamate dehydrogenase (EC 1.4.1.4) |
Gene: cur_0800: NADP-specific glutamate dehydrogenase (EC 1.4.1.4) |
NADP-specific glutamate dehydrogenase (EC 1.4.1.4) |
| CRON 11. | |||||||||
| glnA |
Gene: CORAM0001_1470: Glutamine synthetase type I (EC 6.3.1.2) |
Gene: cauri_1720: Glutamine synthetase type I (EC 6.3.1.2) |
*
Corynebacterium diphtheriae NCTC 13129 Site: position = -117 score = 5.40303 sequence = TTTTTTGATAGCTCTATAGATAAT Gene: DIP1644: Glutamine synthetase type I (EC 6.3.1.2) |
*2
Corynebacterium efficiens YS-314 Gene: CE2116: Glutamine synthetase type I (EC 6.3.1.2) Site: position = -147 score = 5.45141 sequence = AGTTTTGATAGATCGACAGATAAT Gene: CE2104: Glutamine synthetase type I (EC 6.3.1.2) |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -149 score = 5.2429 sequence = AGTTTTGATAGATCGACAGGTAAT Gene: cg2429: Glutamine synthetase type I (EC 6.3.1.2) |
Gene: jk0702: Glutamine synthetase type I (EC 6.3.1.2) |
Gene: ckrop_0695: Glutamine synthetase type I (EC 6.3.1.2) |
2
Corynebacterium urealyticum DSM 7109 Gene: cur_1255: Glutamine synthetase type I (EC 6.3.1.2) Gene: cur_1277: Glutamine synthetase type I (EC 6.3.1.2) |
Glutamine synthetase type I (EC 6.3.1.2) |
| CRON 12. | |||||||||
| cg2181 |
Gene: CORAM0001_2002: Predicted ABC transporter, substrate-binding protein |
|
*
Corynebacterium diphtheriae NCTC 13129 Site: position = -162 score = 4.01277 sequence = TAAAACTATTATTTGATAGTTTTA Gene: DIP0956: Predicted ABC transporter, substrate-binding protein |
Gene: CE1884: Predicted ABC transporter, substrate-binding protein |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -218 score = 5.73849 sequence = AATTTCTATCAAACTATAGAAAGA Gene: cg2181: Predicted ABC transporter, substrate-binding protein |
|
Gene: ckrop_0089: Predicted ABC transporter, substrate-binding protein |
|
Predicted ABC transporter, substrate-binding protein |
| cg2182 |
Gene: CORAM0001_2003: Predicted ABC transporter, permease protein 1 |
Gene: cauri_0214: Predicted ABC transporter, permease protein 1 |
Gene: DIP0957: Predicted ABC transporter, permease protein 1 |
Gene: CE1885: Predicted ABC transporter, permease protein 1 |
Gene: cg2182: Predicted ABC transporter, permease protein 1 |
|
Gene: ckrop_0090: Predicted ABC transporter, permease protein 1 |
|
Predicted ABC transporter, permease protein 1 |
| cg2183 |
Gene: CORAM0001_2004: Predicted ABC transporter, permease protein 2 |
Gene: cauri_0213: Predicted ABC transporter, permease protein 2 |
Gene: DIP0958: Predicted ABC transporter, permease protein 2 |
Gene: CE1886: Predicted ABC transporter, permease protein 2 |
Gene: cg2183: Predicted ABC transporter, permease protein 2 |
|
Gene: ckrop_0091: Predicted ABC transporter, permease protein 2 |
|
Predicted ABC transporter, permease protein 2 |
| cg2184 |
Gene: CORAM0001_2005: Predicted ABC transporter, ATP-binding protein |
Gene: cauri_0212: Predicted ABC transporter, ATP-binding protein |
Gene: DIP0959: Predicted ABC transporter, ATP-binding protein |
Gene: CE1887: Predicted ABC transporter, ATP-binding protein |
Gene: cg2184: Predicted ABC transporter, ATP-binding protein |
|
Gene: ckrop_0092: Predicted ABC transporter, ATP-binding protein |
|
Predicted ABC transporter, ATP-binding protein |
| CRON 13. | |||||||||
| ureA |
|
|
|
*
Corynebacterium efficiens YS-314 Site: position = -25 score = 4.73103 sequence = TCTAACTATTGACTTATAGTTATT Gene: CE0993: Urease, gamma subunit (EC 3.5.1.5) |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -31 score = 4.83986 sequence = AATTTCTGTTACCTGACAGAAAGG Gene: cg0113: Urease, gamma subunit (EC 3.5.1.5) |
|
|
Gene: cur_1771: Urease, gamma subunit (EC 3.5.1.5) |
Urease, gamma subunit (EC 3.5.1.5) |
| ureB |
|
|
|
Gene: CE0994: Urease beta subunit (EC 3.5.1.5) |
Gene: cg0114: Urease beta subunit (EC 3.5.1.5) |
|
|
Gene: cur_1772: Urease beta subunit (EC 3.5.1.5) |
Urease beta subunit (EC 3.5.1.5) |
| ureC |
|
|
|
Gene: CE0995: Urease alpha subunit (EC 3.5.1.5) |
Gene: cg0115: Urease alpha subunit (EC 3.5.1.5) |
|
|
Gene: cur_1773: Urease alpha subunit (EC 3.5.1.5) |
Urease alpha subunit (EC 3.5.1.5) |
| ureE |
|
|
|
Gene: CE0996: Urease accessory protein UreE |
Gene: cg0116: Urease accessory protein UreE |
|
|
Gene: cur_1774: Urease accessory protein UreE |
Urease accessory protein UreE |
| ureF |
|
|
|
Gene: CE0997: Urease accessory protein UreF |
Gene: cg0117: Urease accessory protein UreF |
|
|
Gene: cur_1775: Urease accessory protein UreF |
Urease accessory protein UreF |
| ureG |
|
|
|
Gene: CE0998: Urease accessory protein UreG |
Gene: cg0118: Urease accessory protein UreG |
|
|
Gene: cur_1776: Urease accessory protein UreG |
Urease accessory protein UreG |
| ureD |
|
|
|
Gene: CE0999: Urease accessory protein UreD |
Gene: cg0119: Urease accessory protein UreD |
|
|
Gene: cur_1777: Urease accessory protein UreD |
Urease accessory protein UreD |
| CRON 14. | |||||||||
| amtA |
|
|
|
*
Corynebacterium efficiens YS-314 Site: position = -99 score = 5.30129 sequence = TTAAACTATTGACCGATAGAAACA Site: position = -65 score = 5.08634 sequence = GTTATCTGTTATGCAATAGAAAAT Gene: CE1701: Ammonium transporter |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -100 score = 5.19084 sequence = GAAATCTATAGAACGATAGGTAAA Site: position = -64 score = 5.29044 sequence = TTTATCTATAGCGGAATAGAAAAT Gene: cg1785: Ammonium transporter |
|
|
|
Ammonium transporter |
| ocd |
|
|
|
Gene: CE1700: Ornithine cyclodeaminase (EC 4.3.1.12) |
Gene: cg1784: Ornithine cyclodeaminase (EC 4.3.1.12) |
|
|
|
Ornithine cyclodeaminase (EC 4.3.1.12) |
| soxA |
|
|
|
Gene: CE1699: Sarcosine oxidase |
2
Corynebacterium glutamicum ATCC 13032 Gene: cg1781: Sarcosine oxidase Gene: cg1783: Sarcosine oxidase |
|
|
|
Sarcosine oxidase |
| CRON 15. | |||||||||
| uctT |
|
|
|
*
Corynebacterium efficiens YS-314 Site: position = -117 score = 5.89942 sequence = ATTACCTATCGATCGATAGATAAA Gene: CE0711: Urea carboxylase-related transporter, Amino acid permease family |
|
|
|
|
Urea carboxylase-related transporter, Amino acid permease family |
| ucaB |
|
|
|
Gene: CE0710: Allophanate hydrolase (EC 3.5.1.54) |
|
|
|
|
Allophanate hydrolase (EC 3.5.1.54) |
| CRON 16. | |||||||||
| amt1 |
|
|
|
*
Corynebacterium efficiens YS-314 Site: position = -102 score = 5.63034 sequence = ATTATCGGTCGATCTATAGATAAA Gene: CE0715: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
|
|
|
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
| amt2 |
|
|
|
Gene: CE0714: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
|
|
|
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
| ucaA |
|
|
|
Gene: CE0713: Urea carboxylase (EC 6.3.4.6) |
|
|
|
|
Urea carboxylase (EC 6.3.4.6) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |