Regulon of AmtR in Corynebacterium diphtheriae NCTC 13129

Properties
Regulator type:	Transcription factor
TF locus tag:	DIP0846
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Regulog:	AmtR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By trascription factor - AmtR
By taxonomy - Corynebacteriaceae
By TF family - TetR
By effector - GlnK-AMP, signal transduction protein
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -117 Score: 5.4 Sequence: TTTTTTGATAGCTCTATAGATAAT Locus tag: DIP1644 Name: glnA Funciton: Glutamine synthetase type I (EC 6.3.1.2)
	DIP1644	glnA	Glutamine synthetase type I (EC 6.3.1.2)
Position: -162 Score: 4 Sequence: TAAAACTATTATTTGATAGTTTTA Locus tag: DIP0956 Name: cg2181 Funciton: Predicted ABC transporter, substrate-binding protein Locus tag: DIP0957 Name: cg2182 Funciton: Predicted ABC transporter, permease protein 1 Locus tag: DIP0958 Name: cg2183 Funciton: Predicted ABC transporter, permease protein 2 Locus tag: DIP0959 Name: cg2184 Funciton: Predicted ABC transporter, ATP-binding protein
	DIP0956	cg2181	Predicted ABC transporter, substrate-binding protein
	DIP0957	cg2182	Predicted ABC transporter, permease protein 1
	DIP0958	cg2183	Predicted ABC transporter, permease protein 2
	DIP0959	cg2184	Predicted ABC transporter, ATP-binding protein
Position: -156 Score: 5.3 Sequence: ACTTTCGATAGTTCAATAGGAATT Locus tag: DIP1547 Name: gdh Funciton: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
	DIP1547	gdh	NADP-specific glutamate dehydrogenase (EC 1.4.1.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD