Regulon of AmtR in Corynebacterium glutamicum ATCC 13032

Properties
Regulator type:	Transcription factor
TF locus tag:	cg0986
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Regulog:	AmtR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	35
- Operons	14
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By trascription factor - AmtR
By taxonomy - Corynebacteriaceae
By TF family - TetR
By effector - GlnK-AMP, signal transduction protein
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -100 Score: 5.2 Sequence: GAAATCTATAGAACGATAGGTAAA Position: -64 Score: 5.3 Sequence: TTTATCTATAGCGGAATAGAAAAT Locus tag: cg1785 Name: amtA Funciton: Ammonium transporter Locus tag: cg1784 Name: ocd Funciton: Ornithine cyclodeaminase (EC 4.3.1.12) Locus tag: cg1783 Name: soxA Funciton: Sarcosine oxidase
	cg1785	amtA	Ammonium transporter
	cg1784	ocd	Ornithine cyclodeaminase (EC 4.3.1.12)
	cg1783	soxA	Sarcosine oxidase
Position: -179 Score: 5.4 Sequence: TGTTTCTATCAATCGTTCGATAAT Position: -110 Score: 5.5 Sequence: ACTTTCGATCAACCTATAGGAAAA Locus tag: cg0228 Name: hkm Funciton: Predicted sensor histidine kinase of two-component system
	cg0228	hkm	Predicted sensor histidine kinase of two-component system
Position: -149 Score: 5.2 Sequence: AGTTTTGATAGATCGACAGGTAAT Locus tag: cg2429 Name: glnA Funciton: Glutamine synthetase type I (EC 6.3.1.2)
	cg2429	glnA	Glutamine synthetase type I (EC 6.3.1.2)
Position: -60 Score: 4.9 Sequence: AATACCTGTCAAGCAATAGAATAG Locus tag: cg0104 Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1)
	cg0104	codA	Cytosine deaminase (EC 3.5.4.1)
Position: -79 Score: 5.7 Sequence: CATTTCTATCAATCTATAGAAAGT Position: -33 Score: 6 Sequence: AGTTTCTATAGATTGATAGAAAAG Locus tag: cg0103 Name: crnT Funciton: Creatinine transporter
	cg0103	crnT	Creatinine transporter
Position: -31 Score: 4.8 Sequence: AATTTCTGTTACCTGACAGAAAGG Locus tag: cg0113 Name: ureA Funciton: Urease, gamma subunit (EC 3.5.1.5) Locus tag: cg0114 Name: ureB Funciton: Urease beta subunit (EC 3.5.1.5) Locus tag: cg0115 Name: ureC Funciton: Urease alpha subunit (EC 3.5.1.5) Locus tag: cg0116 Name: ureE Funciton: Urease accessory protein UreE Locus tag: cg0117 Name: ureF Funciton: Urease accessory protein UreF Locus tag: cg0118 Name: ureG Funciton: Urease accessory protein UreG Locus tag: cg0119 Name: ureD Funciton: Urease accessory protein UreD
	cg0113	ureA	Urease, gamma subunit (EC 3.5.1.5)
	cg0114	ureB	Urease beta subunit (EC 3.5.1.5)
	cg0115	ureC	Urease alpha subunit (EC 3.5.1.5)
	cg0116	ureE	Urease accessory protein UreE
	cg0117	ureF	Urease accessory protein UreF
	cg0118	ureG	Urease accessory protein UreG
	cg0119	ureD	Urease accessory protein UreD
Position: -218 Score: 5.7 Sequence: AATTTCTATCAAACTATAGAAAGA Locus tag: cg2181 Name: cg2181 Funciton: Predicted ABC transporter, substrate-binding protein Locus tag: cg2182 Name: cg2182 Funciton: Predicted ABC transporter, permease protein 1 Locus tag: cg2183 Name: cg2183 Funciton: Predicted ABC transporter, permease protein 2 Locus tag: cg2184 Name: cg2184 Funciton: Predicted ABC transporter, ATP-binding protein
	cg2181	cg2181	Predicted ABC transporter, substrate-binding protein
	cg2182	cg2182	Predicted ABC transporter, permease protein 1
	cg2183	cg2183	Predicted ABC transporter, permease protein 2
	cg2184	cg2184	Predicted ABC transporter, ATP-binding protein
Position: -193 Score: 5.2 Sequence: AATATCTATCATGTGATAGGTAAA Locus tag: cg2136 Name: gluA Funciton: Glutamate ABC transporter, ATP-binding protein Locus tag: cg2137 Name: gluB Funciton: Glutamate ABC transporter, substrate-binding protein Locus tag: cg2138 Name: gluC Funciton: Glutamate ABC transporter, permease protein 1 Locus tag: cg2139 Name: gluD Funciton: Glutamate ABC transporter, permease protein 2
	cg2136	gluA	Glutamate ABC transporter, ATP-binding protein
	cg2137	gluB	Glutamate ABC transporter, substrate-binding protein
	cg2138	gluC	Glutamate ABC transporter, permease protein 1
	cg2139	gluD	Glutamate ABC transporter, permease protein 2
Position: -183 Score: 5.4 Sequence: ATTACCTGTTAAACTATAGAAAAT Position: -140 Score: 5 Sequence: CTATTCTATAGATCTATTGAAATT Locus tag: cg2261 Name: amtB Funciton: Ammonium transporter Locus tag: cg2260 Name: glnK Funciton: Nitrogen regulatory protein PII Locus tag: cg2258 Name: glnD Funciton: [Protein-PII] Uridylyltransferase
	cg2261	amtB	Ammonium transporter
	cg2260	glnK	Nitrogen regulatory protein PII
	cg2258	glnD	[Protein-PII] Uridylyltransferase
Position: -115 Score: 5.3 Sequence: TTTTCCTATAGGTTGATCGAAAGT Position: -46 Score: 5.5 Sequence: ATTATCGAACGATTGATAGAAACA Locus tag: cg0229 Name: gltB Funciton: Glutamate synthase [NADPH] large chain (EC 1.4.1.13) Locus tag: cg0230 Name: gltD Funciton: Glutamate synthase [NADPH] small chain (EC 1.4.1.13)
	cg0229	gltB	Glutamate synthase [NADPH] large chain (EC 1.4.1.13)
	cg0230	gltD	Glutamate synthase [NADPH] small chain (EC 1.4.1.13)
Position: -367 Score: 4.9 Sequence: AAAATTGATAAACCTAAAGAAATT Position: -209 Score: 4 Sequence: TAAAACTATTAACCGTTAGTATGA Locus tag: cg2280 Name: gdh Funciton: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
	cg2280	gdh	NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
Position: -41 Score: 6 Sequence: ATTTTCTATCAATCTATAGATACT Locus tag: cg1296 Name: cg1296 Funciton: Predicted non-ribosomal peptide synthetase
	cg1296	cg1296	Predicted non-ribosomal peptide synthetase
Position: -40 Score: 6.2 Sequence: AGTATCTATAGATTGATAGAAAAT Locus tag: cg1295 Name: cg1295 Funciton: Predicted hydrolase/acyltransferase
	cg1295	cg1295	Predicted hydrolase/acyltransferase
Position: -68 Score: 5.1 Sequence: ACTACCTATAGGCTGACAGAAACT Position: -42 Score: 5.5 Sequence: AAAAACTATAGAGCTATAGAAACT Locus tag: cg1061 Name: urtA Funciton: Urea ABC transporter, substrate-binding protein Locus tag: cg1062 Name: urtB Funciton: Urea ABC transporter, permease protein 1 Locus tag: cg1064 Name: urtC Funciton: Urea ABC transporter, permease protein 2 Locus tag: cg1065 Name: urtD Funciton: Urea ABC transporter, ATP-binding protein 1 Locus tag: cg1066 Name: urtE Funciton: Urea ABC transporter, ATP-binding protein 2
	cg1061	urtA	Urea ABC transporter, substrate-binding protein
	cg1062	urtB	Urea ABC transporter, permease protein 1
	cg1064	urtC	Urea ABC transporter, permease protein 2
	cg1065	urtD	Urea ABC transporter, ATP-binding protein 1
	cg1066	urtE	Urea ABC transporter, ATP-binding protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of AmtR in Corynebacterium glutamicum ATCC 13032

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --