Regulon of AmtR in Corynebacterium aurimucosum ATCC 700975

Properties
Regulator type:	Transcription factor
TF locus tag:	cauri_0817
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Regulog:	AmtR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By trascription factor - AmtR
By taxonomy - Corynebacteriaceae
By TF family - TetR
By effector - GlnK-AMP, signal transduction protein
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -86 Score: 5.1 Sequence: AATTTAGGTCGATTGATAGAAAAC Locus tag: cauri_1607 Name: gdh Funciton: NADP-specific glutamate dehydrogenase (EC 1.4.1.4)
	cauri_1607	gdh	NADP-specific glutamate dehydrogenase (EC 1.4.1.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD