Regulog SPy1285 - Streptococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Transport
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - GntR/Others
By pathway - Transport

Statistics of regulated genes
Genome	Genes	Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R	7	3
Streptococcus dysgalactiae subsp. equisimilis GGS_124	9	3
Streptococcus equi subsp. zooepidemicus MGCS10565	10	3
Streptococcus gallolyticus UCN34	9	3
Streptococcus gordonii str. Challis substr. CH1	2	1
Streptococcus mitis B6	6	2
Streptococcus mutans UA159	8	3
Streptococcus pneumoniae TIGR4	7	3
Streptococcus pyogenes M1 GAS	9	3
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33	10	3
Streptococcus thermophilus CNRZ1066	3	1
Streptococcus uberis 0140J	9	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
SPy1285	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	* Streptococcus agalactiae 2603V/R Site: position = -51 score = 6.54465 sequence = TTGTACTATTTTTATAGTACAA Gene: SAG0938: Predicted transcriptional regulator, GntR family	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -51 score = 6.38756 sequence = CTGTACCATTTATTTAGTACAA Gene: SDEG_1097: Predicted transcriptional regulator, GntR family	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -58 score = 6.78019 sequence = TTGTATCATTTAATTAGTACAA Gene: Sez_0879: Predicted transcriptional regulator, GntR family	* Streptococcus gallolyticus UCN34 Site: position = -57 score = 6.14089 sequence = CTGTACCATTTATGTAGTACAA Gene: GALLO_0987: Predicted transcriptional regulator, GntR family	Streptococcus gordonii str. Challis substr. CH1	* Streptococcus mitis B6 Site: position = -46 score = 6.6785 sequence = TTGTATTATTTAATTAAGACAA Gene: smi_0581: Predicted transcriptional regulator, GntR family	* Streptococcus mutans UA159 Site: position = -52 score = 6.588 sequence = TTGTATTATATATATAACACAA Gene: SMU.1193: Predicted transcriptional regulator, GntR family	* Streptococcus pneumoniae TIGR4 Site: position = -46 score = 6.6785 sequence = TTGTATTATTTAATTAAGACAA Gene: SP_1714: Predicted transcriptional regulator, GntR family	* Streptococcus pyogenes M1 GAS Site: position = -51 score = 6.4557 sequence = CTGTACCATTTAATTAGTACAA Gene: SPy1285: Predicted transcriptional regulator, GntR family	Streptococcus sanguinis SK36	* Streptococcus suis 05ZYH33 Site: position = -48 score = 5.91404 sequence = TTGTATTATTAAGATAAGACAT Gene: SSU05_0541: Predicted transcriptional regulator, GntR family	* Streptococcus thermophilus CNRZ1066 Site: position = -59 score = 6.29072 sequence = TTGTATCATTACTTTAGTACAA Gene: str1435: Predicted transcriptional regulator, GntR family	* Streptococcus uberis 0140J Site: position = -54 score = 6.52385 sequence = CTGTACCATTTAAATAGTACAA Gene: SUB1003: Predicted transcriptional regulator, GntR family	Predicted transcriptional regulator, GntR family
SPy1286	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1098: Predicted ABC transporter, ATP-binding protein 1	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0878: Predicted ABC transporter, ATP-binding protein 1	Streptococcus gallolyticus UCN34 Gene: GALLO_0986: Predicted ABC transporter, ATP-binding protein 1	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1342: Predicted ABC transporter, ATP-binding protein 1	Streptococcus mitis B6 Gene: smi_0580: Predicted ABC transporter, ATP-binding protein 1	Streptococcus mutans UA159 Gene: SMU.1194: Predicted ABC transporter, ATP-binding protein 1	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS Gene: SPy1286: Predicted ABC transporter, ATP-binding protein 1	Streptococcus sanguinis SK36 Gene: SSA_0845: Predicted ABC transporter, ATP-binding protein 1	Streptococcus suis 05ZYH33 Gene: SSU05_0540: Predicted ABC transporter, ATP-binding protein 1	Streptococcus thermophilus CNRZ1066 Gene: str1436: Predicted ABC transporter, ATP-binding protein 1	Streptococcus uberis 0140J Gene: SUB1004: Predicted ABC transporter, ATP-binding protein 1	Predicted ABC transporter, ATP-binding protein 1
SPy1287	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1099: Predicted ABC transporter, ATP-binding protein 2	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0877: Predicted ABC transporter, ATP-binding protein 2	Streptococcus gallolyticus UCN34 Gene: GALLO_0985: Predicted ABC transporter, ATP-binding protein 2	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1343: Predicted ABC transporter, ATP-binding protein 2	Streptococcus mitis B6 Gene: smi_0579: Predicted ABC transporter, ATP-binding protein 2	Streptococcus mutans UA159 Gene: SMU.1195: Predicted ABC transporter, ATP-binding protein 2	Streptococcus pneumoniae TIGR4 Gene: SP_1715: Predicted ABC transporter, ATP-binding protein 2	Streptococcus pyogenes M1 GAS Gene: SPy1287: Predicted ABC transporter, ATP-binding protein 2	Streptococcus sanguinis SK36 Gene: SSA_0844: Predicted ABC transporter, ATP-binding protein 2	Streptococcus suis 05ZYH33 Gene: SSU05_0539: Predicted ABC transporter, ATP-binding protein 2	Streptococcus thermophilus CNRZ1066 Gene: str1437: Predicted ABC transporter, ATP-binding protein 2	Streptococcus uberis 0140J Gene: SUB1005: Predicted ABC transporter, ATP-binding protein 2	Predicted ABC transporter, ATP-binding protein 2

CRON 2.
SPy0836	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	* Streptococcus agalactiae 2603V/R Site: position = -35 score = 6.20622 sequence = TTGTTCTATATTAATAATACAA Gene: SAG1361: Predicted ABC transporter, periplasmic protein	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -37 score = 6.6362 sequence = TTGTCTTATAAAAATAGTACAA Gene: SDEG_0798: Predicted ABC transporter, periplasmic protein	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -37 score = 6.2285 sequence = TTGTCTTAAAAAAATAGTACAA Gene: Sez_1122: Predicted ABC transporter, periplasmic protein	* Streptococcus gallolyticus UCN34 Site: position = -48 score = 5.64208 sequence = TTGTCTTATCGCAACAATACAA Gene: GALLO_1332: Predicted ABC transporter, periplasmic protein	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0750: Predicted ABC transporter, periplasmic protein	* Streptococcus mitis B6 Site: position = -153 score = 6.45495 sequence = GTGTATTATATATCTAGTACAA Gene: smi_0839: Predicted ABC transporter, periplasmic protein	* Streptococcus mutans UA159 Site: position = -112 score = 5.85187 sequence = TTGTATTATAGCCTTAAGACAA Gene: SMU.862: Predicted ABC transporter, periplasmic protein	* Streptococcus pneumoniae TIGR4 Site: position = -129 score = 6.45495 sequence = GTGTATTATATATCTAGTACAA Gene: SP_0785: Predicted ABC transporter, periplasmic protein	* Streptococcus pyogenes M1 GAS Site: position = -37 score = 6.47 sequence = TTGTCTTATACAAATAGTACAA Gene: SPy0836: Predicted ABC transporter, periplasmic protein	Streptococcus sanguinis SK36 Gene: SSA_1532: Predicted ABC transporter, periplasmic protein	* Streptococcus suis 05ZYH33 Site: position = -28 score = 5.86828 sequence = GTGTATTATATAGACAACACAA Gene: SSU05_0513: Predicted ABC transporter, periplasmic protein	Streptococcus thermophilus CNRZ1066	* Streptococcus uberis 0140J Site: position = -37 score = 6.54257 sequence = TTGTCTTATATTAATAATACAA Gene: SUB0736: Predicted ABC transporter, periplasmic protein	Predicted ABC transporter, periplasmic protein
SPy0837	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R Gene: SAG1360: Predicted ABC transporter, ATP-binding protein	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_0799: Predicted ABC transporter, ATP-binding protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1121: Predicted ABC transporter, ATP-binding protein	Streptococcus gallolyticus UCN34 Gene: GALLO_1331: Predicted ABC transporter, ATP-binding protein	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0751: Predicted ABC transporter, ATP-binding protein	Streptococcus mitis B6 Gene: smi_0840: Predicted ABC transporter, ATP-binding protein	Streptococcus mutans UA159 Gene: SMU.863: Predicted ABC transporter, ATP-binding protein	Streptococcus pneumoniae TIGR4 Gene: SP_0786: Predicted ABC transporter, ATP-binding protein	Streptococcus pyogenes M1 GAS Gene: SPy0837: Predicted ABC transporter, ATP-binding protein	Streptococcus sanguinis SK36 Gene: SSA_1531: Predicted ABC transporter, ATP-binding protein	2 Streptococcus suis 05ZYH33 Gene: SSU05_0514: Predicted ABC transporter, ATP-binding protein Gene: SSU05_0515: Predicted ABC transporter, ATP-binding protein	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB0737: Predicted ABC transporter, ATP-binding protein	Predicted ABC transporter, ATP-binding protein
SPy0838	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R Gene: SAG1359: Predicted ABC transporter, permease protein	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_0800: Predicted ABC transporter, permease protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1120: Predicted ABC transporter, permease protein	Streptococcus gallolyticus UCN34 Gene: GALLO_1330: Predicted ABC transporter, permease protein	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0752: Predicted ABC transporter, permease protein	Streptococcus mitis B6 Gene: smi_0841: Predicted ABC transporter, permease protein	Streptococcus mutans UA159 Gene: SMU.864: Predicted ABC transporter, permease protein	Streptococcus pneumoniae TIGR4 Gene: SP_0787: Predicted ABC transporter, permease protein	Streptococcus pyogenes M1 GAS Gene: SPy0838: Predicted ABC transporter, permease protein	Streptococcus sanguinis SK36 Gene: SSA_1530: Predicted ABC transporter, permease protein	2 Streptococcus suis 05ZYH33 Gene: SSU05_0517: Predicted ABC transporter, permease protein Gene: SSU05_0516: Predicted ABC transporter, permease protein	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB0738: Predicted ABC transporter, permease protein	Predicted ABC transporter, permease protein

CRON 3.
SAG0279	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	* Streptococcus agalactiae 2603V/R Site: position = -56 score = 5.27941 sequence = TTGTATATATAAAATAATACAA Gene: SAG0279: hypothetical protein	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -39 score = 5.07544 sequence = TTGTATTAGCGTAAAAGTACAA Gene: SDEG_1734: hypothetical protein	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -39 score = 4.51397 sequence = TTGTATTAGCGTAAACGTACAA Gene: Sez_1597: hypothetical protein	* Streptococcus gallolyticus UCN34 Site: position = -43 score = 5.68893 sequence = TTGTGTTACTTTAATAGTACAA Gene: GALLO_0401: hypothetical protein	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	* Streptococcus pyogenes M1 GAS Site: position = -39 score = 5.07544 sequence = TTGTATTAGCGTAAAAGTACAA Gene: SPy1675: hypothetical protein	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	* Streptococcus uberis 0140J Site: position = -34 score = 5.65198 sequence = TTGTATTAGATTAAAAGTACAA Gene: SUB1426: hypothetical protein	hypothetical protein
SAG0280	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R Gene: SAG0280: ABC-type multidrug transport system, ATPase component	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1733: ABC-type multidrug transport system, ATPase component	2 Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1596: ABC-type multidrug transport system, ATPase component Gene: Sez_1595: ABC-type multidrug transport system, ATPase component	Streptococcus gallolyticus UCN34 Gene: GALLO_0402: ABC-type multidrug transport system, ATPase component	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -42 score = 4.12907 sequence = ATATATAATAAATATATTATAA Gene: SGO_0798: ABC-type multidrug transport system, ATPase component	Streptococcus mitis B6 Gene: smi_0751: ABC-type multidrug transport system, ATPase component	* Streptococcus mutans UA159 Site: position = -46 score = 5.36643 sequence = TTGTATGATTTCAGTAGTATAA Gene: SMU.1041: ABC-type multidrug transport system, ATPase component	* Streptococcus pneumoniae TIGR4 Site: position = -57 score = 4.33534 sequence = TTGTATCAAAGTGCTAGTATAG Gene: SP_1381: ABC-type multidrug transport system, ATPase component	Streptococcus pyogenes M1 GAS Gene: SPy1674: ABC-type multidrug transport system, ATPase component	Streptococcus sanguinis SK36 Gene: SSA_1026: ABC-type multidrug transport system, ATPase component	* Streptococcus suis 05ZYH33 Site: position = -124 score = 5.00488 sequence = TTGTACTAATTCAGCAGTATAA Gene: SSU05_0748: ABC-type multidrug transport system, ATPase component	Streptococcus thermophilus CNRZ1066 Gene: str1713: ABC-type multidrug transport system, ATPase component	Streptococcus uberis 0140J Gene: SUB1425: ABC-type multidrug transport system, ATPase component	ABC-type multidrug transport system, ATPase component
SAG0281	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0981: ABC transporter permease protein	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R Gene: SAG0281: ABC transporter permease protein	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1732: ABC transporter permease protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1594: ABC transporter permease protein	Streptococcus gallolyticus UCN34 Gene: GALLO_0403: ABC transporter permease protein	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0799: ABC transporter permease protein	Streptococcus mitis B6 Gene: smi_0752: ABC transporter permease protein	Streptococcus mutans UA159 Gene: SMU.1042: ABC transporter permease protein	Streptococcus pneumoniae TIGR4 Gene: SP_1380: ABC transporter permease protein	Streptococcus pyogenes M1 GAS Gene: SPy1673: ABC transporter permease protein	Streptococcus sanguinis SK36 Gene: SSA_1027: ABC transporter permease protein	Streptococcus suis 05ZYH33 Gene: SSU05_0747: ABC transporter permease protein	Streptococcus thermophilus CNRZ1066 Gene: str1712: ABC transporter permease protein	Streptococcus uberis 0140J Gene: SUB1424: ABC transporter permease protein	ABC transporter permease protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SPy1285 - Streptococcaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --