Regulon of SPy1285 in Streptococcus pyogenes M1 GAS

Properties
Regulator type:	Transcription factor
TF locus tag:	SPy1285
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Transport
Effector:
Regulog:	SPy1285 - Streptococcaceae
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - GntR/Others
By pathway - Transport

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 6.5 Sequence: CTGTACCATTTAATTAGTACAA Locus tag: SPy1285 Name: SPy1285 Funciton: Predicted transcriptional regulator, GntR family Locus tag: SPy1286 Name: SPy1286 Funciton: Predicted ABC transporter, ATP-binding protein 1 Locus tag: SPy1287 Name: SPy1287 Funciton: Predicted ABC transporter, ATP-binding protein 2
	SPy1285	SPy1285	Predicted transcriptional regulator, GntR family
	SPy1286	SPy1286	Predicted ABC transporter, ATP-binding protein 1
	SPy1287	SPy1287	Predicted ABC transporter, ATP-binding protein 2
Position: -37 Score: 6.5 Sequence: TTGTCTTATACAAATAGTACAA Locus tag: SPy0836 Name: SPy0836 Funciton: Predicted ABC transporter, periplasmic protein Locus tag: SPy0837 Name: SPy0837 Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: SPy0838 Name: SPy0838 Funciton: Predicted ABC transporter, permease protein
	SPy0836	SPy0836	Predicted ABC transporter, periplasmic protein
	SPy0837	SPy0837	Predicted ABC transporter, ATP-binding protein
	SPy0838	SPy0838	Predicted ABC transporter, permease protein
Position: -39 Score: 5.1 Sequence: TTGTATTAGCGTAAAAGTACAA Locus tag: SPy1675 Name: SAG0279 Funciton: hypothetical protein Locus tag: SPy1674 Name: SAG0280 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: SPy1673 Name: SAG0281 Funciton: ABC transporter permease protein
	SPy1675	SAG0279	hypothetical protein
	SPy1674	SAG0280	ABC-type multidrug transport system, ATPase component
	SPy1673	SAG0281	ABC transporter permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD