Regulon of SPy1285 in Streptococcus mitis B6

Properties
Regulator type:	Transcription factor
TF locus tag:	smi_0581
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Transport
Effector:
Regulog:	SPy1285 - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - GntR/Others
By pathway - Transport

Regulated operons
	Locus Tag	Name	Function
Position: -153 Score: 6.5 Sequence: GTGTATTATATATCTAGTACAA Locus tag: smi_0839 Name: SPy0836 Funciton: Predicted ABC transporter, periplasmic protein Locus tag: smi_0840 Name: SPy0837 Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: smi_0841 Name: SPy0838 Funciton: Predicted ABC transporter, permease protein
	smi_0839	SPy0836	Predicted ABC transporter, periplasmic protein
	smi_0840	SPy0837	Predicted ABC transporter, ATP-binding protein
	smi_0841	SPy0838	Predicted ABC transporter, permease protein
Position: -46 Score: 6.7 Sequence: TTGTATTATTTAATTAAGACAA Locus tag: smi_0581 Name: SPy1285 Funciton: Predicted transcriptional regulator, GntR family Locus tag: smi_0580 Name: SPy1286 Funciton: Predicted ABC transporter, ATP-binding protein 1 Locus tag: smi_0579 Name: SPy1287 Funciton: Predicted ABC transporter, ATP-binding protein 2
	smi_0581	SPy1285	Predicted transcriptional regulator, GntR family
	smi_0580	SPy1286	Predicted ABC transporter, ATP-binding protein 1
	smi_0579	SPy1287	Predicted ABC transporter, ATP-binding protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD