Regulon of SPy1285 in Streptococcus mutans UA159

Properties
Regulator type:	Transcription factor
TF locus tag:	SMU.1193
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Transport
Effector:
Regulog:	SPy1285 - Streptococcaceae
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - GntR/Others
By pathway - Transport

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 6.6 Sequence: TTGTATTATATATATAACACAA Locus tag: SMU.1193 Name: SPy1285 Funciton: Predicted transcriptional regulator, GntR family Locus tag: SMU.1194 Name: SPy1286 Funciton: Predicted ABC transporter, ATP-binding protein 1 Locus tag: SMU.1195 Name: SPy1287 Funciton: Predicted ABC transporter, ATP-binding protein 2
	SMU.1193	SPy1285	Predicted transcriptional regulator, GntR family
	SMU.1194	SPy1286	Predicted ABC transporter, ATP-binding protein 1
	SMU.1195	SPy1287	Predicted ABC transporter, ATP-binding protein 2
Position: -46 Score: 5.4 Sequence: TTGTATGATTTCAGTAGTATAA Locus tag: SMU.1041 Name: SAG0280 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: SMU.1042 Name: SAG0281 Funciton: ABC transporter permease protein
	SMU.1041	SAG0280	ABC-type multidrug transport system, ATPase component
	SMU.1042	SAG0281	ABC transporter permease protein
Position: -112 Score: 5.9 Sequence: TTGTATTATAGCCTTAAGACAA Locus tag: SMU.862 Name: SPy0836 Funciton: Predicted ABC transporter, periplasmic protein Locus tag: SMU.863 Name: SPy0837 Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: SMU.864 Name: SPy0838 Funciton: Predicted ABC transporter, permease protein
	SMU.862	SPy0836	Predicted ABC transporter, periplasmic protein
	SMU.863	SPy0837	Predicted ABC transporter, ATP-binding protein
	SMU.864	SPy0838	Predicted ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD