Regulon of SPy1285 in Streptococcus uberis 0140J

Properties
Regulator type:	Transcription factor
TF locus tag:	SUB1003
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Transport
Effector:
Regulog:	SPy1285 - Streptococcaceae
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - GntR/Others
By pathway - Transport

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 6.5 Sequence: CTGTACCATTTAAATAGTACAA Locus tag: SUB1003 Name: SPy1285 Funciton: Predicted transcriptional regulator, GntR family Locus tag: SUB1004 Name: SPy1286 Funciton: Predicted ABC transporter, ATP-binding protein 1 Locus tag: SUB1005 Name: SPy1287 Funciton: Predicted ABC transporter, ATP-binding protein 2
	SUB1003	SPy1285	Predicted transcriptional regulator, GntR family
	SUB1004	SPy1286	Predicted ABC transporter, ATP-binding protein 1
	SUB1005	SPy1287	Predicted ABC transporter, ATP-binding protein 2
Position: -37 Score: 6.5 Sequence: TTGTCTTATATTAATAATACAA Locus tag: SUB0736 Name: SPy0836 Funciton: Predicted ABC transporter, periplasmic protein Locus tag: SUB0737 Name: SPy0837 Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: SUB0738 Name: SPy0838 Funciton: Predicted ABC transporter, permease protein
	SUB0736	SPy0836	Predicted ABC transporter, periplasmic protein
	SUB0737	SPy0837	Predicted ABC transporter, ATP-binding protein
	SUB0738	SPy0838	Predicted ABC transporter, permease protein
Position: -34 Score: 5.7 Sequence: TTGTATTAGATTAAAAGTACAA Locus tag: SUB1426 Name: SAG0279 Funciton: hypothetical protein Locus tag: SUB1425 Name: SAG0280 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: SUB1424 Name: SAG0281 Funciton: ABC transporter permease protein
	SUB1426	SAG0279	hypothetical protein
	SUB1425	SAG0280	ABC-type multidrug transport system, ATPase component
	SUB1424	SAG0281	ABC transporter permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD