Regulon of SPy1285 in Streptococcus suis 05ZYH33

Properties
Regulator type:	Transcription factor
TF locus tag:	SSU05_0541
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Transport
Effector:
Regulog:	SPy1285 - Streptococcaceae
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - GntR/Others
By pathway - Transport

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 5 Sequence: TTGTACTAATTCAGCAGTATAA Locus tag: SSU05_0748 Name: SAG0280 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: SSU05_0747 Name: SAG0281 Funciton: ABC transporter permease protein
	SSU05_0748	SAG0280	ABC-type multidrug transport system, ATPase component
	SSU05_0747	SAG0281	ABC transporter permease protein
Position: -48 Score: 5.9 Sequence: TTGTATTATTAAGATAAGACAT Locus tag: SSU05_0541 Name: SPy1285 Funciton: Predicted transcriptional regulator, GntR family Locus tag: SSU05_0540 Name: SPy1286 Funciton: Predicted ABC transporter, ATP-binding protein 1 Locus tag: SSU05_0539 Name: SPy1287 Funciton: Predicted ABC transporter, ATP-binding protein 2
	SSU05_0541	SPy1285	Predicted transcriptional regulator, GntR family
	SSU05_0540	SPy1286	Predicted ABC transporter, ATP-binding protein 1
	SSU05_0539	SPy1287	Predicted ABC transporter, ATP-binding protein 2
Position: -28 Score: 5.9 Sequence: GTGTATTATATAGACAACACAA Locus tag: SSU05_0513 Name: SPy0836 Funciton: Predicted ABC transporter, periplasmic protein Locus tag: SSU05_0514 Name: SPy0837 Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: SSU05_0515 Name: SPy0837 Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: SSU05_0516 Name: SPy0838 Funciton: Predicted ABC transporter, permease protein Locus tag: SSU05_0517 Name: SPy0838 Funciton: Predicted ABC transporter, permease protein
	SSU05_0513	SPy0836	Predicted ABC transporter, periplasmic protein
	SSU05_0514	SPy0837	Predicted ABC transporter, ATP-binding protein
	SSU05_0515	SPy0837	Predicted ABC transporter, ATP-binding protein
	SSU05_0516	SPy0838	Predicted ABC transporter, permease protein
	SSU05_0517	SPy0838	Predicted ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD