Regulon of SPy1285 in Streptococcus thermophilus CNRZ1066

Properties
Regulator type:	Transcription factor
TF locus tag:	str1435
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Transport
Effector:
Regulog:	SPy1285 - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - GntR/Others
By pathway - Transport

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6.3 Sequence: TTGTATCATTACTTTAGTACAA Locus tag: str1435 Name: SPy1285 Funciton: Predicted transcriptional regulator, GntR family Locus tag: str1436 Name: SPy1286 Funciton: Predicted ABC transporter, ATP-binding protein 1 Locus tag: str1437 Name: SPy1287 Funciton: Predicted ABC transporter, ATP-binding protein 2
	str1435	SPy1285	Predicted transcriptional regulator, GntR family
	str1436	SPy1286	Predicted ABC transporter, ATP-binding protein 1
	str1437	SPy1287	Predicted ABC transporter, ATP-binding protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD