Regulog RutR3 - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RutR
- By TF family - TetR
- By effector - Uracil
- By pathway - Pyrimidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Azotobacter vinelandii AvOP | ||
| Pseudomonas aeruginosa PAO1 | 5 | 2 |
| Pseudomonas entomophila L48 | 7 | 4 |
| Pseudomonas fluorescens Pf-5 | 5 | 2 |
| Pseudomonas mendocina ymp | 6 | 3 |
| Pseudomonas putida KT2440 | 6 | 3 |
| Pseudomonas stutzeri A1501 | 4 | 1 |
| Pseudomonas syringae pv. tomato str. DC3000 | 4 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| pbuT2 |
|
Gene: PA0352: Xanthine/uracil permease |
*
Pseudomonas entomophila L48 Site: position = -127 score = 5.58281 sequence = AATTGACCTAAAAGTCAGCT Gene: PSEEN2224: Xanthine/uracil permease |
|
|
Gene: PP3992: Xanthine/uracil permease |
|
|
Xanthine/uracil permease |
| CRON 2. | |||||||||
| tsx |
|
|
*
Pseudomonas entomophila L48 Site: position = -71 score = 4.70981 sequence = AGCTGACCCAAAAGACAAGA Gene: PSEEN1679: Nucleoside-binding outer membrane protein |
|
|
*
Pseudomonas putida KT2440 Site: position = -74 score = 4.80247 sequence = AGCTGACTCAAAAGACAAAA Gene: PP4293: Nucleoside-binding outer membrane protein |
|
|
Nucleoside-binding outer membrane protein |
| CRON 3. | |||||||||
| rutR3 |
|
Gene: PA1504: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: PSEEN1675: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: PFL_1703: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
*
Pseudomonas mendocina ymp Site: position = -119 score = 5.247 sequence = ATTTGACTCAAGAGTCAGAT Gene: Pmen_2767: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: PP4295: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: PST_3101: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Gene: PSPTO3698: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
| CRON 4. | |||||||||
| xdhA |
Gene: Avin_22290: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
*
Pseudomonas aeruginosa PAO1 Site: position = -139 score = 5.35349 sequence = ATTTGACTCAAAAGTCAGTT Site: position = -163 score = 4.14616 sequence = GACTGACCTACAGGTCAAAA Gene: PA1524: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
*
Pseudomonas entomophila L48 Site: position = -95 score = 5.941 sequence = TCTTGACCCAAAGGTCAGAA Site: position = -72 score = 5.28235 sequence = TATTGACCACAAGGTCAGGC Gene: PSEEN1765: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
*
Pseudomonas fluorescens Pf-5 Site: position = -76 score = 5.05284 sequence = CATTGACCGAAAAGTCAGAC Site: position = -99 score = 4.69346 sequence = TCCTGACCTTGAAGTCAGAA Gene: PFL_1889: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
*
Pseudomonas mendocina ymp Site: position = -123 score = 5.941 sequence = TGTTGACCCAAAAGTCAGAA Site: position = -146 score = 4.56974 sequence = AGCTGACCACAGGGTCAAAT Gene: Pmen_2751: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
*
Pseudomonas putida KT2440 Site: position = -93 score = 5.24233 sequence = TCTTGACCCTTGAGTCAGAA Site: position = -70 score = 4.73413 sequence = TATTGACCTGCTAGACAGGT Gene: PP4278: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
*
Pseudomonas stutzeri A1501 Site: position = -211 score = 5.7942 sequence = AGTTGACCGAAAAGTCAGAT Site: position = -234 score = 4.22533 sequence = CATTGACTTTTGAGTCAGGA Gene: PST_3081: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -72 score = 4.53371 sequence = AATTGACCCAATTGGCAGAG Site: position = -95 score = 4.60453 sequence = TCCTGACTTAAGAGTCAGAA Gene: PSPTO3660: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) |
| xdhB |
Gene: Avin_22280: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Gene: PA1523: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Gene: PSEEN1764: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Gene: PFL_1888: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Gene: Pmen_2752: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Gene: PP4279: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Gene: PST_3082: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Gene: PSPTO3661: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) |
| xdhC |
Gene: Avin_22270: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
Gene: PA1522: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
Gene: PSEEN1763: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
Gene: PFL_1887: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
Gene: Pmen_2753: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
Gene: PP4280: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
Gene: PST_3083: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
Gene: PSPTO3662: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) |
| guaD |
Gene: Avin_22260: Guanine deaminase (EC 3.5.4.3) |
Gene: PA1521: Guanine deaminase (EC 3.5.4.3) |
Gene: PSEEN1762: Guanine deaminase (EC 3.5.4.3) |
Gene: PFL_1886: Guanine deaminase (EC 3.5.4.3) |
Gene: Pmen_2754: Guanine deaminase (EC 3.5.4.3) |
Gene: PP4281: Guanine deaminase (EC 3.5.4.3) |
Gene: PST_3084: Guanine deaminase (EC 3.5.4.3) |
Gene: PSPTO3663: Guanine deaminase (EC 3.5.4.3) |
Guanine deaminase (EC 3.5.4.3) |
| CRON 5. | |||||||||
| pbuT |
|
*
Pseudomonas aeruginosa PAO1 Site: position = -115 score = 5.84685 sequence = TCTTGACCCAGAGGTCAGAA Gene: PA1519: Xanthine/uracil permease |
*
Pseudomonas entomophila L48 Site: position = -121 score = 4.72878 sequence = TCCTGACCCAGAAGTCAACA Gene: PSEEN1759: Xanthine/uracil permease |
*
Pseudomonas fluorescens Pf-5 Site: position = -114 score = 5.20596 sequence = TCTTGACCCACAGGTCAACA Gene: PFL_4364: Xanthine/uracil permease |
*
Pseudomonas mendocina ymp Site: position = -123 score = 4.50729 sequence = TCTTGACCGCTCGGTCAACA Gene: Pmen_2756: Xanthine/uracil permease |
*
Pseudomonas putida KT2440 Site: position = -114 score = 5.31244 sequence = TCTTGACCCATAAGTCAACA Gene: PP4284: Xanthine/uracil permease |
Gene: PST_3090: Xanthine/uracil permease |
|
Xanthine/uracil permease |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |