Regulon of RutR3 in Pseudomonas aeruginosa PAO1

Properties
Regulator type:	Transcription factor
TF locus tag:	PA1504
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR3 - Pseudomonadaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By trascription factor - RutR
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -163 Score: 4.1 Sequence: GACTGACCTACAGGTCAAAA Position: -139 Score: 5.4 Sequence: ATTTGACTCAAAAGTCAGTT Locus tag: PA1524 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: PA1523 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: PA1522 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: PA1521 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
	PA1524	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	PA1523	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	PA1522	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	PA1521	guaD	Guanine deaminase (EC 3.5.4.3)
Position: -115 Score: 5.8 Sequence: TCTTGACCCAGAGGTCAGAA Locus tag: PA1519 Name: pbuT Funciton: Xanthine/uracil permease
	PA1519	pbuT	Xanthine/uracil permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD