Regulon of RutR3 in Pseudomonas entomophila L48

Properties
Regulator type:	Transcription factor
TF locus tag:	PSEEN1675
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR3 - Pseudomonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By trascription factor - RutR
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -95 Score: 5.9 Sequence: TCTTGACCCAAAGGTCAGAA Position: -72 Score: 5.3 Sequence: TATTGACCACAAGGTCAGGC Locus tag: PSEEN1765 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: PSEEN1764 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: PSEEN1763 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: PSEEN1762 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
	PSEEN1765	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	PSEEN1764	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	PSEEN1763	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	PSEEN1762	guaD	Guanine deaminase (EC 3.5.4.3)
Position: -121 Score: 4.7 Sequence: TCCTGACCCAGAAGTCAACA Locus tag: PSEEN1759 Name: pbuT Funciton: Xanthine/uracil permease
	PSEEN1759	pbuT	Xanthine/uracil permease
Position: -71 Score: 4.7 Sequence: AGCTGACCCAAAAGACAAGA Locus tag: PSEEN1679 Name: tsx Funciton: Nucleoside-binding outer membrane protein
	PSEEN1679	tsx	Nucleoside-binding outer membrane protein
Position: -127 Score: 5.6 Sequence: AATTGACCTAAAAGTCAGCT Locus tag: PSEEN2224 Name: pbuT2 Funciton: Xanthine/uracil permease
	PSEEN2224	pbuT2	Xanthine/uracil permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD