Regulon of RutR3 in Pseudomonas fluorescens Pf-5

Properties
Regulator type:	Transcription factor
TF locus tag:	PFL_2447
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR3 - Pseudomonadaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By trascription factor - RutR
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -99 Score: 4.7 Sequence: TCCTGACCTTGAAGTCAGAA Position: -76 Score: 5.1 Sequence: CATTGACCGAAAAGTCAGAC Locus tag: PFL_1889 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: PFL_1888 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: PFL_1887 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: PFL_1886 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
	PFL_1889	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	PFL_1888	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	PFL_1887	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	PFL_1886	guaD	Guanine deaminase (EC 3.5.4.3)
Position: -114 Score: 5.2 Sequence: TCTTGACCCACAGGTCAACA Locus tag: PFL_4364 Name: pbuT Funciton: Xanthine/uracil permease
	PFL_4364	pbuT	Xanthine/uracil permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD