Regulon of RutR3 in Pseudomonas putida KT2440

Properties
Regulator type:	Transcription factor
TF locus tag:	PP4295
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR3 - Pseudomonadaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By trascription factor - RutR
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -93 Score: 5.2 Sequence: TCTTGACCCTTGAGTCAGAA Position: -70 Score: 4.7 Sequence: TATTGACCTGCTAGACAGGT Locus tag: PP4278 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: PP4279 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: PP4280 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: PP4281 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3)
	PP4278	xdhA	Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4)
	PP4279	xdhB	Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4)
	PP4280	xdhC	XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase)
	PP4281	guaD	Guanine deaminase (EC 3.5.4.3)
Position: -114 Score: 5.3 Sequence: TCTTGACCCATAAGTCAACA Locus tag: PP4284 Name: pbuT Funciton: Xanthine/uracil permease
	PP4284	pbuT	Xanthine/uracil permease
Position: -74 Score: 4.8 Sequence: AGCTGACTCAAAAGACAAAA Locus tag: PP4293 Name: tsx Funciton: Nucleoside-binding outer membrane protein
	PP4293	tsx	Nucleoside-binding outer membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD